ID: 1176072764

View in Genome Browser
Species Human (GRCh38)
Location 20:63235555-63235577
Sequence CGCAGCCCTAGGCCCCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176072758_1176072764 7 Left 1176072758 20:63235525-63235547 CCGGGTGACCTGCCTCCCTGCTC No data
Right 1176072764 20:63235555-63235577 CGCAGCCCTAGGCCCCTGTGAGG No data
1176072762_1176072764 -9 Left 1176072762 20:63235541-63235563 CCTGCTCTGCGTGACGCAGCCCT No data
Right 1176072764 20:63235555-63235577 CGCAGCCCTAGGCCCCTGTGAGG No data
1176072760_1176072764 -5 Left 1176072760 20:63235537-63235559 CCTCCCTGCTCTGCGTGACGCAG No data
Right 1176072764 20:63235555-63235577 CGCAGCCCTAGGCCCCTGTGAGG No data
1176072761_1176072764 -8 Left 1176072761 20:63235540-63235562 CCCTGCTCTGCGTGACGCAGCCC No data
Right 1176072764 20:63235555-63235577 CGCAGCCCTAGGCCCCTGTGAGG No data
1176072759_1176072764 -1 Left 1176072759 20:63235533-63235555 CCTGCCTCCCTGCTCTGCGTGAC No data
Right 1176072764 20:63235555-63235577 CGCAGCCCTAGGCCCCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176072764 Original CRISPR CGCAGCCCTAGGCCCCTGTG AGG Intergenic
No off target data available for this crispr