ID: 1176072772

View in Genome Browser
Species Human (GRCh38)
Location 20:63235579-63235601
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176072760_1176072772 19 Left 1176072760 20:63235537-63235559 CCTCCCTGCTCTGCGTGACGCAG No data
Right 1176072772 20:63235579-63235601 TAGAGTCACCCCCGCAAGGTGGG No data
1176072765_1176072772 -4 Left 1176072765 20:63235560-63235582 CCCTAGGCCCCTGTGAGGCTAGA No data
Right 1176072772 20:63235579-63235601 TAGAGTCACCCCCGCAAGGTGGG No data
1176072759_1176072772 23 Left 1176072759 20:63235533-63235555 CCTGCCTCCCTGCTCTGCGTGAC No data
Right 1176072772 20:63235579-63235601 TAGAGTCACCCCCGCAAGGTGGG No data
1176072762_1176072772 15 Left 1176072762 20:63235541-63235563 CCTGCTCTGCGTGACGCAGCCCT No data
Right 1176072772 20:63235579-63235601 TAGAGTCACCCCCGCAAGGTGGG No data
1176072761_1176072772 16 Left 1176072761 20:63235540-63235562 CCCTGCTCTGCGTGACGCAGCCC No data
Right 1176072772 20:63235579-63235601 TAGAGTCACCCCCGCAAGGTGGG No data
1176072766_1176072772 -5 Left 1176072766 20:63235561-63235583 CCTAGGCCCCTGTGAGGCTAGAG No data
Right 1176072772 20:63235579-63235601 TAGAGTCACCCCCGCAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176072772 Original CRISPR TAGAGTCACCCCCGCAAGGT GGG Intergenic
No off target data available for this crispr