ID: 1176072776

View in Genome Browser
Species Human (GRCh38)
Location 20:63235588-63235610
Sequence CCCCGCAAGGTGGGAGGTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176072767_1176072776 -2 Left 1176072767 20:63235567-63235589 CCCCTGTGAGGCTAGAGTCACCC No data
Right 1176072776 20:63235588-63235610 CCCCGCAAGGTGGGAGGTCACGG No data
1176072768_1176072776 -3 Left 1176072768 20:63235568-63235590 CCCTGTGAGGCTAGAGTCACCCC No data
Right 1176072776 20:63235588-63235610 CCCCGCAAGGTGGGAGGTCACGG No data
1176072762_1176072776 24 Left 1176072762 20:63235541-63235563 CCTGCTCTGCGTGACGCAGCCCT No data
Right 1176072776 20:63235588-63235610 CCCCGCAAGGTGGGAGGTCACGG No data
1176072766_1176072776 4 Left 1176072766 20:63235561-63235583 CCTAGGCCCCTGTGAGGCTAGAG No data
Right 1176072776 20:63235588-63235610 CCCCGCAAGGTGGGAGGTCACGG No data
1176072769_1176072776 -4 Left 1176072769 20:63235569-63235591 CCTGTGAGGCTAGAGTCACCCCC No data
Right 1176072776 20:63235588-63235610 CCCCGCAAGGTGGGAGGTCACGG No data
1176072765_1176072776 5 Left 1176072765 20:63235560-63235582 CCCTAGGCCCCTGTGAGGCTAGA No data
Right 1176072776 20:63235588-63235610 CCCCGCAAGGTGGGAGGTCACGG No data
1176072761_1176072776 25 Left 1176072761 20:63235540-63235562 CCCTGCTCTGCGTGACGCAGCCC No data
Right 1176072776 20:63235588-63235610 CCCCGCAAGGTGGGAGGTCACGG No data
1176072760_1176072776 28 Left 1176072760 20:63235537-63235559 CCTCCCTGCTCTGCGTGACGCAG No data
Right 1176072776 20:63235588-63235610 CCCCGCAAGGTGGGAGGTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176072776 Original CRISPR CCCCGCAAGGTGGGAGGTCA CGG Intergenic
No off target data available for this crispr