ID: 1176074445

View in Genome Browser
Species Human (GRCh38)
Location 20:63242051-63242073
Sequence CTGTTTCAGAGGAGGCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 409}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176074433_1176074445 20 Left 1176074433 20:63242008-63242030 CCCCAAACTAGGATTGTGTACGG 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1176074445 20:63242051-63242073 CTGTTTCAGAGGAGGCCAGGTGG 0: 1
1: 0
2: 1
3: 32
4: 409
1176074437_1176074445 18 Left 1176074437 20:63242010-63242032 CCAAACTAGGATTGTGTACGGGG 0: 1
1: 0
2: 1
3: 0
4: 27
Right 1176074445 20:63242051-63242073 CTGTTTCAGAGGAGGCCAGGTGG 0: 1
1: 0
2: 1
3: 32
4: 409
1176074435_1176074445 19 Left 1176074435 20:63242009-63242031 CCCAAACTAGGATTGTGTACGGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1176074445 20:63242051-63242073 CTGTTTCAGAGGAGGCCAGGTGG 0: 1
1: 0
2: 1
3: 32
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176074445 Original CRISPR CTGTTTCAGAGGAGGCCAGG TGG Intronic
900331611 1:2137578-2137600 CAGATACAGAGGAGGCCATGTGG - Intronic
900401429 1:2474443-2474465 CTGCTGCTGAGGAGGTCAGGGGG + Intronic
900566699 1:3335829-3335851 CAGGTTCACAGGAGGCCCGGGGG + Intronic
900585889 1:3432171-3432193 CTCTGGCTGAGGAGGCCAGGTGG - Intronic
900776522 1:4589819-4589841 CTATTTAGGAGGAGGCCAGAGGG - Intergenic
900981534 1:6048799-6048821 CTGCTTCTGAGGTGGCCATGTGG - Intronic
903457473 1:23497685-23497707 CTGTTTGGGAAAAGGCCAGGTGG - Intergenic
904953578 1:34264173-34264195 CTGTCTCAGGGGTGGCTAGGTGG - Intergenic
907279959 1:53340889-53340911 CTGTTTTGGAGGAGAGCAGGTGG - Intergenic
908583991 1:65548985-65549007 CTCTTTCAGGGCAGGCCTGGTGG + Intronic
911074308 1:93857683-93857705 CTGTTTTAGGGCAGGCCTGGTGG - Intergenic
912743404 1:112223237-112223259 CTCTTTCAGGGCAGGCCTGGTGG - Intergenic
913070177 1:115291637-115291659 CTGGTTCAGAAGAGGGCAAGAGG - Intronic
913931121 1:124966017-124966039 CTGTTTTAGGGCAGGCCTGGTGG + Intergenic
914388365 1:147194684-147194706 CTCTTTTAGAGCAGGCCTGGTGG + Intronic
915654118 1:157344468-157344490 CTCTTTCAGGGCAGGCCTGGTGG + Intergenic
915981202 1:160420892-160420914 CTCTCCCAGAGGTGGCCAGGAGG + Intronic
916020220 1:160785009-160785031 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
916431507 1:164733508-164733530 CTGTTTCAAAGGAGGCCCAAAGG + Intronic
917182672 1:172316203-172316225 CTCTTTCAGGGCAGGCCTGGTGG - Intronic
917592132 1:176487266-176487288 CTGTTTCAGAGGAGTGCACATGG - Intronic
918072335 1:181142071-181142093 CTGTTTCTGAGAAAGCCTGGTGG - Intergenic
919919158 1:202158058-202158080 CTGTATCAGAGGCAGCCAGCTGG - Intronic
920307839 1:205030462-205030484 CTCTTTCAGATGAGGTCTGGTGG - Intergenic
920632021 1:207661822-207661844 CTGTTTTAGGGCAGGCCTGGTGG + Intronic
921640568 1:217547817-217547839 ATGTGTCAGAGGAGGTCTGGCGG + Intronic
921960178 1:221026121-221026143 CTGTTTGGGACTAGGCCAGGGGG + Intergenic
923053155 1:230403106-230403128 CTGTTAGAGAAGAGGCCTGGAGG - Intronic
923378377 1:233389779-233389801 ATGTTTAAGGGGAGGTCAGGGGG - Intergenic
1062762639 10:37288-37310 CTGTTTTAGGGCAGGCCTGGTGG - Intergenic
1064618689 10:17191979-17192001 CAGTGTCAGATGAGGCAAGGTGG + Intronic
1065380552 10:25085926-25085948 CTGTTTCAAAAGAGTACAGGTGG + Intergenic
1066157601 10:32695389-32695411 ATGTATCAGAGAAGGCCAAGGGG + Intronic
1067772263 10:49135236-49135258 ATGTTTCAGAGGAGACCGGAAGG - Intergenic
1067903295 10:50264345-50264367 CTCTTTCAGGGCAGGCCTGGTGG - Intergenic
1069484447 10:68812582-68812604 CAGTGTCAGTGGAGGCCACGTGG - Intergenic
1069759831 10:70801120-70801142 ACGTTTCACATGAGGCCAGGAGG + Intergenic
1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG + Intronic
1071386658 10:85127696-85127718 CTCTTTCAGGGCAGGCCTGGTGG - Intergenic
1071941564 10:90596836-90596858 CTGTTTCTAATGAGGCCAGGAGG + Intergenic
1072013784 10:91326030-91326052 CTCTTTTAGAGCAGGCCTGGTGG + Intergenic
1072040352 10:91600842-91600864 CTGGTTCCCATGAGGCCAGGTGG - Intergenic
1072696452 10:97607307-97607329 TGGTGTCAGAGCAGGCCAGGGGG - Intronic
1072743795 10:97926160-97926182 CTGTTTCTGTGGAGCCCAGAAGG + Intronic
1072855249 10:98939050-98939072 CTGTTTTAGGGCAGGCCTGGTGG - Intronic
1072859249 10:98985456-98985478 CTGTTTTAGGGCAGGCCTGGTGG - Intronic
1072874249 10:99154567-99154589 CTGTTTTAGGGCAGGCCTGGTGG - Intronic
1073123556 10:101136129-101136151 CTGCCTCAGAGGAAGCCAGTGGG + Intronic
1073575848 10:104622508-104622530 TGGTGTCAGAGGAGGCCTGGTGG + Intergenic
1073575878 10:104622635-104622657 TTGTGTCAGTGGAGGCCAGTTGG + Intergenic
1075404507 10:122185621-122185643 TTTTTTCAGAGAAGACCAGGTGG + Intronic
1076258107 10:129044878-129044900 CTGGTTCTGAGCAGGGCAGGGGG - Intergenic
1076266803 10:129115034-129115056 CTGTTTCAGTGCAGGCGAGGAGG - Intergenic
1076568062 10:131412263-131412285 CTGTTTCACAGGAGCACGGGCGG + Intergenic
1076580729 10:131508740-131508762 CTCTTTTAGAGCAGGCCTGGTGG + Intergenic
1077488041 11:2848059-2848081 CTCCTTCAGAGAGGGCCAGGTGG - Exonic
1077920688 11:6639924-6639946 CTGTGGCAGAGGAGGCTAGAGGG + Exonic
1078688837 11:13559137-13559159 CTGTTTTAGGGCAGGCCTGGTGG + Intergenic
1078999390 11:16738640-16738662 CTGTGGCAGAGAAGGCCCGGAGG + Exonic
1079487486 11:20950614-20950636 CTGTTTCAGAGAAGGGGAGAAGG - Intronic
1079516362 11:21273867-21273889 CTCTTTCAGGGCAGGCCTGGTGG - Intronic
1079808269 11:24961924-24961946 CTGTTTTAGGGCAGGCCTGGTGG + Intronic
1080164691 11:29223131-29223153 CTGTTGCAGGGCAGGCCTGGTGG + Intergenic
1080252059 11:30244524-30244546 CTGTTGCTAAGGAGGCAAGGTGG - Intergenic
1081172207 11:39882850-39882872 CTCTTTTAGAGCAGGCCTGGTGG - Intergenic
1081738296 11:45420496-45420518 CAGATTCAGAGGAGGCCTAGGGG + Intergenic
1082754904 11:57064716-57064738 CTGTTGTAGAGCAGGCCTGGTGG - Intergenic
1083196343 11:61090833-61090855 CTGTGGAAGAGGAGGCCTGGCGG + Intergenic
1083267679 11:61554329-61554351 CATATGCAGAGGAGGCCAGGAGG + Intronic
1083270871 11:61571928-61571950 CTTGGTCAGAGGAGCCCAGGTGG - Intronic
1084282389 11:68106749-68106771 ATGTTTAAGAGGATGCCAGAAGG + Intronic
1086661800 11:89428184-89428206 CTCTTTTAGGGGAGGCCTGGTGG - Intronic
1087631385 11:100654323-100654345 CTCTTTTAGAGCAGGCCTGGTGG - Intergenic
1089671884 11:120062429-120062451 CAGTGACAGAGGAGGCCCGGAGG + Intergenic
1089995403 11:122902230-122902252 GTGGATCACAGGAGGCCAGGAGG + Intronic
1090461731 11:126897155-126897177 CTGGGTCAGAGGAGCACAGGTGG + Intronic
1090640594 11:128726200-128726222 CAGCTTCAGGGGAGGGCAGGGGG - Intronic
1091518809 12:1214533-1214555 CTCTTTGAGGGGAGGCCGGGAGG - Intronic
1091619802 12:2078096-2078118 TAGGTTCAGATGAGGCCAGGAGG + Intronic
1092069317 12:5619951-5619973 CTGTTTCTGAGCAGGCCCAGAGG + Intronic
1093217521 12:16381316-16381338 CTCTTTCAGGGCAGGCCTGGTGG + Intronic
1093332268 12:17857369-17857391 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1093341104 12:17974894-17974916 CTGTTTCACAGGAGACTACGAGG - Intergenic
1094075723 12:26471881-26471903 CTGCTTCAGAAGTGGCCATGTGG - Intronic
1094132769 12:27092627-27092649 CTGTTTTAGGGCAGGCCTGGTGG - Intergenic
1094776186 12:33730776-33730798 CTCTTGCAGAGCAGGCCTGGCGG + Intergenic
1094792667 12:33932384-33932406 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1096270761 12:50164668-50164690 CAGTGTCAGAGGAGTACAGGTGG - Intronic
1097734423 12:63166426-63166448 CTGTTTTAGGGCAGGCCTGGTGG + Intergenic
1097807469 12:63981772-63981794 CTGTTTCTGGGGAGTCCTGGGGG - Intronic
1098209213 12:68145126-68145148 GAGGTTCAGAGGAGGTCAGGAGG - Intergenic
1098237638 12:68433042-68433064 GGGTTTCAGAGGAGGCCTGGGGG + Intergenic
1098533109 12:71563319-71563341 CTGGTGCAGTGGAGGTCAGGAGG - Intronic
1099026466 12:77470156-77470178 CTATTTCTGAGGAGGCCTGAAGG - Intergenic
1099086790 12:78256197-78256219 CTCTTTCAGGGCAGGCCTGGTGG + Intergenic
1099268565 12:80479341-80479363 CTCTTTTAGAGCAGGCCTGGTGG - Intronic
1104422132 12:128645073-128645095 CTGTTTCAGTGAAGGCCAGGAGG - Intronic
1109137856 13:58676799-58676821 CTCTTTCAGGGCAGGCCTGGTGG + Intergenic
1109989955 13:70041603-70041625 CTGTGTCAGTGGATGCCAGATGG - Intronic
1111844755 13:93494700-93494722 CTCTTTCAGGGCAGGCCTGGTGG + Intronic
1111986151 13:95068888-95068910 CTGTTCCTGATGGGGCCAGGGGG - Intronic
1113404529 13:110025933-110025955 GTTTTCCAGTGGAGGCCAGGTGG - Intergenic
1114706169 14:24728483-24728505 CTCTTTCAGGGCAGGCCTGGTGG - Intergenic
1114801691 14:25783034-25783056 CTCTTTTAGAGCAGGCCTGGTGG + Intergenic
1114872687 14:26677496-26677518 CTCTTTCAGGGCAGGCCTGGTGG + Intergenic
1115434753 14:33360061-33360083 GTGTGTCAGCGGAGGCCAGTGGG - Intronic
1116808091 14:49512776-49512798 CTTTTTCTCAGGAGCCCAGGAGG - Intergenic
1118011950 14:61618557-61618579 CAGTTTCAGAAGAGGCTAGAAGG - Intronic
1121002977 14:90465335-90465357 TTGTTTCACAGGAGCCCAGAGGG - Intergenic
1122842172 14:104471301-104471323 CTGGCTCGGAGGATGCCAGGAGG + Intergenic
1123225073 15:17015564-17015586 CTCTTTTAGAGCAGGCCTGGTGG - Intergenic
1124372899 15:29113535-29113557 CTGTGCCGTAGGAGGCCAGGTGG + Intronic
1128252770 15:66174487-66174509 ATGTTACAGGAGAGGCCAGGAGG - Intronic
1128599655 15:68985227-68985249 CTATGTCAGAGGAGGGCAGATGG + Intronic
1128649306 15:69398824-69398846 CTGAGTCAGAGGAGGGCAGAGGG + Intronic
1129490447 15:75920233-75920255 CTTTTTCAGAGTTGGTCAGGTGG + Intronic
1129621817 15:77154662-77154684 CTCTTTCAGGGCAGGCCTGGTGG + Intronic
1129715233 15:77844239-77844261 CTGTTGGAGAAGAGGCCTGGTGG + Intergenic
1129866373 15:78911754-78911776 CTGTTTCCCAGGAGGCCCTGTGG + Intergenic
1129940203 15:79489964-79489986 CTGTTTTAGGGCAGGCCTGGTGG + Intergenic
1131083999 15:89560132-89560154 CAGTGGCAGAGGAGGCCTGGTGG + Intergenic
1131289175 15:91090527-91090549 CTCTTTCAGGGCAGGCCTGGTGG - Intergenic
1132110331 15:99098123-99098145 CTGTTTCATAGGAGCACAGCAGG - Intergenic
1132343573 15:101093092-101093114 CTGTGTCCGACAAGGCCAGGAGG + Intergenic
1132561276 16:595368-595390 CTGCTTCACAGGAGGCCTGCAGG - Intronic
1134007450 16:10827789-10827811 GTGTTGCTGGGGAGGCCAGGCGG - Intergenic
1134253721 16:12593673-12593695 CTCTTTCAGGGCAGGCCTGGTGG - Intergenic
1134879757 16:17735108-17735130 CTCTTTTAGGGCAGGCCAGGTGG - Intergenic
1135065672 16:19307700-19307722 CTCTTGCAGGGGAGCCCAGGAGG + Intronic
1135209523 16:20512372-20512394 CTCTTGCAGGGGAGGCCAGAGGG + Intergenic
1135220548 16:20611174-20611196 CTTGTTCAGAGGATGCCTGGTGG + Intronic
1136569729 16:31089376-31089398 CTGTTTCCCAGGAAGCCAGCAGG - Intronic
1138448204 16:57077848-57077870 CTGCGGGAGAGGAGGCCAGGTGG - Intronic
1138559913 16:57795252-57795274 CTGGTCCAGATGTGGCCAGGAGG + Intronic
1138914028 16:61440701-61440723 CTATTGCACAGGAGGTCAGGAGG + Intergenic
1140305735 16:73800838-73800860 CTGTGTGAGAGCAGGCCACGGGG + Intergenic
1140454285 16:75095804-75095826 CTGATACAGAGGGGGACAGGGGG - Intronic
1141809361 16:86364568-86364590 CTATGTCAGATGATGCCAGGCGG - Intergenic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1143101927 17:4509226-4509248 TGGTTTCAGAGGAGGAAAGGAGG + Intronic
1143455363 17:7064273-7064295 GTGATTCAGAGTCGGCCAGGTGG + Intergenic
1144248805 17:13395154-13395176 ATATTTCACAGGAGGCCAGAAGG - Intergenic
1144379435 17:14679643-14679665 CTGCTTCAGAGGGTGCCTGGTGG - Intergenic
1146488309 17:33261864-33261886 CTATCCCAGAGGAGGCCAGCTGG + Intronic
1146762623 17:35491608-35491630 CTGTTTCCCAGCAGGCCAGGTGG - Intronic
1146970516 17:37068065-37068087 CTGTGTCTGAGGACGCCTGGCGG - Intergenic
1148943963 17:51241920-51241942 CTGTCCCAGAGTAGGCCAGTGGG + Intronic
1149059685 17:52408015-52408037 CTCTTTTAGAGCAGGCCTGGTGG + Intergenic
1150983211 17:70167738-70167760 CTGTTTCTTAGAAGTCCAGGAGG + Intergenic
1151517156 17:74604072-74604094 CTGGGTGAGAGAAGGCCAGGAGG - Intergenic
1151929749 17:77224804-77224826 CTGTTTCTGGGGAGGCCTCGGGG + Intergenic
1152111162 17:78358477-78358499 CTTTCTCATAGGAGTCCAGGTGG + Exonic
1152919841 17:83060731-83060753 CTGCTTCTGAGGAGGCCTCGGGG - Intergenic
1152955549 18:37619-37641 CTGTTTTAGGGCAGGCCTGGTGG - Intergenic
1154167162 18:12024595-12024617 TTGTCCCAGAGGAGGCCATGGGG - Intronic
1154171485 18:12056244-12056266 CTGTTTCTAAGGAGGCATGGTGG - Intergenic
1156111173 18:33729260-33729282 CTGTTCCACAGGAGGACAGCAGG + Intronic
1156316314 18:35972343-35972365 CTGTCAGAGAGGAGGCGAGGCGG + Exonic
1156323060 18:36046334-36046356 CTGTATCACAGGAGGCCTAGTGG + Intronic
1157205694 18:45696413-45696435 CTCTTTTAGAGCAGGCCTGGTGG - Intergenic
1157572875 18:48724512-48724534 CAGAATCAGAGGAGGCCAGCAGG - Intronic
1159828927 18:73249487-73249509 GTGTGTCAAAGGAGGCCAGGTGG + Intronic
1160107892 18:75995091-75995113 CTGGTTGGGAGGGGGCCAGGAGG + Intergenic
1160271479 18:77388781-77388803 CTGTTGCAGTAGAGGCCAGAAGG - Intergenic
1160870141 19:1274229-1274251 CTGTTTCCGGGGAGGCCGGGAGG + Intronic
1160884342 19:1338411-1338433 CTGTTTCTAGGGATGCCAGGTGG + Intergenic
1161731852 19:5965506-5965528 CTATTTCAGAGGCAGCAAGGAGG + Intronic
1162911851 19:13851813-13851835 CTGTTTCGGGGCAGGCAAGGAGG - Intergenic
1163855754 19:19700904-19700926 CTATTCAAGAGGAGGCCAGAAGG - Intergenic
1163871567 19:19825521-19825543 CTATTCAAGAGGAGGCCAGAGGG + Intergenic
1164396435 19:27867890-27867912 TTATCTCACAGGAGGCCAGGAGG + Intergenic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1164626437 19:29731633-29731655 CTGAATCAGCGGAGGCCAGGAGG + Intergenic
1165463480 19:35958464-35958486 CTGGTTCTGAGGAGGCTGGGCGG + Intergenic
1166700665 19:44879717-44879739 GTGTTACAGAGGAGGCATGGAGG - Intronic
1168192566 19:54750319-54750341 CTAATTCACAGGAGGACAGGTGG + Intronic
1168194645 19:54765148-54765170 CTAATTCACAGGAGGACAGGTGG + Intronic
1168196897 19:54781595-54781617 CTAATTCACAGGAGGACAGGTGG + Intronic
1168202697 19:54828033-54828055 CTAATTCACAGGAGGACAGGTGG + Intronic
1168205265 19:54845853-54845875 CTAATTCACAGGAGGACAGGTGG + Intronic
1168207499 19:54862063-54862085 CTAATTCACAGGAGGACAGGTGG + Intronic
1202658564 1_KI270708v1_random:47706-47728 CTCTTTTAGAGCAGGCCTGGTGG + Intergenic
925368787 2:3328729-3328751 CTGATTCAGGGGAGCCCAGCTGG - Intronic
925368813 2:3328843-3328865 CTGATTCAGGGGAGCCCAGCTGG - Intronic
925368894 2:3329187-3329209 CTGATTCAGGGGAGCCCAGCTGG - Intronic
925368920 2:3329301-3329323 CTGATTCAGGGGAGCCCAGCTGG - Intronic
925388118 2:3477109-3477131 CTGTGGCAGAGGAGGCCTGGGGG - Intronic
925904335 2:8530331-8530353 CTCTTTCAGAGGGTGCCAGGAGG + Intergenic
926334586 2:11853664-11853686 CTGTTTGTGAGGTGGCAAGGGGG + Intergenic
926931971 2:18049750-18049772 GTGTGTCAGAGCAGGCAAGGGGG - Intronic
927334584 2:21907495-21907517 CTGTTTTAGGGCAGGCCTGGTGG + Intergenic
929919394 2:46161653-46161675 GTGTGGCAGAGGAAGCCAGGGGG + Intronic
929997308 2:46836696-46836718 CTGTAGCAGCGGAGGCCAAGTGG - Intronic
931520539 2:63091853-63091875 CTCTTTCAGGGCAGGCCTGGTGG + Intergenic
932593661 2:73081302-73081324 CTTTCCCAGGGGAGGCCAGGGGG + Intronic
933197773 2:79411710-79411732 CTCTTTTAGAGCAGGCCTGGTGG - Intronic
935631059 2:105212518-105212540 CTCTTTCAGGGCAGGCCTGGTGG + Intergenic
935738916 2:106129342-106129364 TGGTTTCAGAGGAGGGGAGGGGG + Intronic
936905094 2:117527187-117527209 CTCTTTTAGAGCAGGCCTGGTGG - Intergenic
937265118 2:120610437-120610459 CTTTTTAAGAGGAGCCCAGGAGG + Intergenic
937556104 2:123158631-123158653 CTGTTTCAAAGGAGTCAAAGTGG - Intergenic
937884196 2:126889108-126889130 CTGCTGCAGAGGAGGAGAGGAGG - Intergenic
939678744 2:145104628-145104650 CTGTTTTAGAGGGGACAAGGAGG + Intergenic
939846898 2:147257634-147257656 ATGTTTCAGGGAAGGACAGGAGG + Intergenic
941416139 2:165224025-165224047 CTGCTTCTGGGGAGGCCATGGGG + Intergenic
944125976 2:196293149-196293171 CTGTTTCAGAGTAGGACTGGGGG - Intronic
946366246 2:219250876-219250898 CTGGTGCATAGGTGGCCAGGGGG + Exonic
946369423 2:219271590-219271612 CTGGTGCATAGGTGGCCAGGGGG - Intronic
948982072 2:241499498-241499520 CTGTGCCCTAGGAGGCCAGGTGG - Intronic
1169388822 20:5173123-5173145 CTCTCTCAGGGGAAGCCAGGTGG - Intronic
1169511180 20:6265849-6265871 GTGATTCTGAGGAGGCCAGAAGG + Intergenic
1170604542 20:17865765-17865787 ATGTTTTAGGGGAGGCCAAGAGG - Intergenic
1171226833 20:23448988-23449010 CTGTTTCAGCGGGGCCCAGGTGG - Intergenic
1171454799 20:25262442-25262464 CTCTTTTAGAGCAGGCCTGGTGG - Intronic
1173301221 20:41805449-41805471 CTGTTTTAGGGCAGGCCTGGTGG + Intergenic
1173301896 20:41810704-41810726 CAGTTTCAGTGGAGACCATGTGG + Intergenic
1174062633 20:47843476-47843498 CTTTATAAGAGGAGGGCAGGAGG + Intergenic
1174928233 20:54784335-54784357 CTCTTTTAGAGCAGGCCTGGTGG - Intergenic
1175264191 20:57692628-57692650 CAGATGCAGAGGAGGCCAAGTGG + Intronic
1175419916 20:58824955-58824977 CTGCTTCAGAGCATGCCAGCAGG + Intergenic
1175615641 20:60396043-60396065 TTGTTTCAAAGAAGGCTAGGGGG - Intergenic
1175692144 20:61073236-61073258 CAGGGTCAGAGGGGGCCAGGGGG - Intergenic
1176007908 20:62876190-62876212 CTGTTCCACAGGAGGCCGGGAGG - Intergenic
1176074445 20:63242051-63242073 CTGTTTCAGAGGAGGCCAGGTGG + Intronic
1176296309 21:5075311-5075333 CTGGATCAGAGGGGGCCAGAGGG - Intergenic
1176935462 21:14861457-14861479 CTGTCTCAGAGGAGGAGATGAGG - Intergenic
1178315019 21:31559960-31559982 ATTTTACAGAGGAGCCCAGGAGG - Intronic
1178391037 21:32198593-32198615 CTGCTCCAGAGGAGCCCAGCAGG + Intergenic
1178675985 21:34632059-34632081 CTGTTTCATAGGAGTCCATTCGG - Intergenic
1178968949 21:37154002-37154024 CTGCTTTAGGGGAGGGCAGGGGG - Intronic
1179645167 21:42771171-42771193 CTTGTTCAGAGGAGGCCATGGGG + Intronic
1179860740 21:44186810-44186832 CTGGATCAGAGGGGGCCAGAGGG + Intergenic
1180326034 22:11431224-11431246 CTCTTTTAGAGCAGGCCTGGTGG + Intergenic
1180990478 22:19932758-19932780 CTGCTTCAGACAAGGCCAAGAGG + Intronic
1181710736 22:24686090-24686112 CTGAGCCAGGGGAGGCCAGGCGG + Intergenic
1182803672 22:33052461-33052483 CTGTTTGGGAGGAGGAAAGGAGG + Intronic
1183379134 22:37482064-37482086 CTGAGGCATAGGAGGCCAGGAGG + Intronic
1184066903 22:42126396-42126418 CTGTCTCAAATGCGGCCAGGCGG + Intergenic
949712821 3:6891409-6891431 CTCTTTTAGAGCAGGCCTGGTGG + Intronic
949717370 3:6949232-6949254 CTCTTTTAGAGCAGGCCTGGTGG + Intronic
949964062 3:9340314-9340336 CTGCTTCAGAGCAGGCCAGATGG + Intronic
951410933 3:22365799-22365821 CTCTTTCAGAGGATGCTATGGGG - Intronic
953214591 3:40906585-40906607 CTCTTTCAGGGCAGGCCTGGTGG + Intergenic
953436251 3:42880473-42880495 CTGATTCAGCGGAGGCCTGGAGG + Intronic
955211671 3:56947092-56947114 CTGTTTTAGGGCAGGCCTGGTGG - Intronic
956782982 3:72619026-72619048 CGGTTTCTGAGGAGGGCAGCTGG + Intergenic
957565595 3:81880076-81880098 CTCTTTTAGAGCAGGCCTGGTGG - Intergenic
957942170 3:87019058-87019080 CTCTTTTAGAGCAGGCCTGGTGG - Intergenic
960940380 3:122929295-122929317 TTGTGTCAGAGGAGGCCTGGAGG + Intronic
961617912 3:128198127-128198149 TTGTTTCAGGGTAGGCAAGGGGG + Intronic
961943468 3:130660773-130660795 TTGTTAGAGATGAGGCCAGGTGG - Intronic
962053340 3:131842387-131842409 CTACTTCAGAGGTGGCCAGCAGG + Intronic
962285670 3:134084095-134084117 CAGCTTCCCAGGAGGCCAGGAGG - Intronic
962337472 3:134548292-134548314 CTGCTTCTGAGGTGGCAAGGAGG - Intronic
963493715 3:146033738-146033760 CAGTTTTAAAGGAGGCCAGGAGG + Intergenic
964751732 3:160059904-160059926 CAGTTTCAGAGAAAGTCAGGTGG + Intergenic
965650634 3:170929106-170929128 CTGTTTTAGGGCAGGCCTGGTGG + Intergenic
965660427 3:171036377-171036399 CAGTATCAGTGGAGGCCACGTGG - Intergenic
966136769 3:176707503-176707525 CTCTTTCAGGGCAGGCCTGGTGG - Intergenic
966250304 3:177858617-177858639 CTCTTGCAGGGCAGGCCAGGTGG + Intergenic
966422232 3:179745140-179745162 CTGGTTCAGAGAAGGCCTGAAGG - Exonic
966680432 3:182636700-182636722 TTTTTTCAGGAGAGGCCAGGTGG + Intergenic
967336000 3:188345424-188345446 CTGATTCAGAAAAGGGCAGGAGG - Intronic
967809889 3:193749283-193749305 CTGCTTCAGGGGAGGCCTGAGGG + Intergenic
968283161 3:197492246-197492268 CTGTGTTAGAGGAGGGGAGGAGG + Intergenic
968417552 4:453230-453252 CTATTTAGGAGGAGGCCAGAGGG + Intronic
968881188 4:3301026-3301048 GTGTTACAGAGGAGGGCAGCCGG - Intronic
968881198 4:3301060-3301082 GTGTTACAGAGGAGGGCAGCCGG - Intronic
968881215 4:3301126-3301148 GTGTTACAGAGGAGGGCAGCCGG - Intronic
968881225 4:3301160-3301182 GTGTTACAGAGGAGGGCAGCCGG - Intronic
969196490 4:5567461-5567483 AGGATGCAGAGGAGGCCAGGAGG - Intronic
969276118 4:6137021-6137043 CTGGTGCAGAGGAGGACTGGAGG - Intronic
969892496 4:10272733-10272755 CCGTTTCAGAGGGGACCAGGAGG - Intergenic
970046145 4:11856873-11856895 CTGCTGCAGTGGAGGGCAGGAGG - Intergenic
970085020 4:12336374-12336396 CTGTTTTAGGGCAGGCCTGGTGG - Intergenic
971640852 4:29130933-29130955 ATGTCTCAGAGGAGCCCAGATGG - Intergenic
972501222 4:39679880-39679902 CTGTCTCAGTGGAGACCATGTGG - Intergenic
973018513 4:45171184-45171206 CTCTTTCAGGGCAGGCCTGGTGG + Intergenic
973066706 4:45804432-45804454 CTGTTTTAGGGCAGGCCTGGTGG - Intergenic
973859125 4:55043235-55043257 CTCTTTTAGGGCAGGCCAGGTGG - Intergenic
975255901 4:72235047-72235069 CTCTTTTAGAGCAGGCCTGGTGG + Intergenic
976198323 4:82555548-82555570 CTGTGTAAGAGGAGGCCTGATGG - Intronic
976691927 4:87877329-87877351 TGGCTTCAGAGGAGGCCTGGTGG + Intergenic
978194377 4:105953858-105953880 CTGTTTCATAGGAAACAAGGTGG - Intronic
980094548 4:128475750-128475772 CTGTTGCAGAGGAACCAAGGAGG - Intergenic
981096399 4:140786843-140786865 CTGTTTTAGGGCAGGCCTGGTGG + Intergenic
981493987 4:145371166-145371188 CTCTTTTAGAGCAGGCCTGGTGG - Intergenic
982070358 4:151688846-151688868 CTGTCTCAGAGGAGGCAGAGGGG - Intronic
983799166 4:171904959-171904981 CTGTTTTAGGGCAGGCCTGGTGG - Intronic
984215954 4:176912620-176912642 CTCTTGCAGGGGAGGCCTGGTGG - Intergenic
984295420 4:177848083-177848105 CTGTTTTAGGGCAGGCCTGGTGG + Intronic
986311088 5:6551657-6551679 CTGGTACAGAGGAGGCCAGTGGG - Intergenic
986681088 5:10233261-10233283 GTGTCTCAGTGGAGGCCATGAGG - Intronic
987057251 5:14205654-14205676 GTGTTTCAGAAGATGCCAGTTGG + Intronic
988736398 5:34026242-34026264 CAGGCTCTGAGGAGGCCAGGTGG + Intronic
989951904 5:50309153-50309175 CTCTTTCAGGGGAGGCCCGGTGG - Intergenic
989985425 5:50691331-50691353 CTGCTTCAGTGGAGTCCTGGAGG - Intronic
990142293 5:52719709-52719731 CTGTTTTAGGGCAGGCCTGGTGG - Intergenic
991160020 5:63488354-63488376 CTGTTTTAGGGCAGGCCTGGTGG + Intergenic
991167775 5:63583739-63583761 CTCTTTCAGGGCAGGCCTGGTGG - Intergenic
991209642 5:64089133-64089155 CTGTTTTAGGGCAGGCCTGGTGG - Intergenic
991213371 5:64133274-64133296 CTGTTTTAGGGCAGGCCTGGTGG + Intergenic
992235893 5:74708255-74708277 CTCTTTCAGGGCAGGCCTGGTGG - Intronic
992514431 5:77476638-77476660 CTCTTTTAGAGCAGGCCTGGTGG - Intronic
993370495 5:87086366-87086388 CTCTTGCAGAGCAGGCCTGGTGG - Intergenic
995676932 5:114672697-114672719 CTGTTTTAGGGCAGGCCTGGTGG - Intergenic
997345145 5:133184898-133184920 CTCTTTTAGGGGAGGCCTGGTGG + Intergenic
997377511 5:133407915-133407937 CTGATTCAGAGGAGGACTTGAGG + Intronic
997578468 5:135002139-135002161 CTCTTTTAGGGGAGGCCTGGTGG + Intronic
997639207 5:135437586-135437608 CTGTTTCAGGGGAGGGAAGAGGG - Intergenic
997847541 5:137301505-137301527 CTGTTCTAGAGTAGGCCAAGGGG - Intronic
998464340 5:142331377-142331399 CTGATCCAGATGAGTCCAGGTGG - Intergenic
999064588 5:148672375-148672397 CTCTTTCAGGGCAGGCCTGGTGG + Intronic
999576057 5:152978648-152978670 CGGATTCCTAGGAGGCCAGGAGG + Intergenic
999947059 5:156609221-156609243 CTGTTTTAGGGCAGGCCTGGTGG + Intronic
1000404759 5:160875349-160875371 CTCTTTTAGAGCAGGCCTGGTGG - Intergenic
1000720090 5:164694886-164694908 CTCTTGCAGAGCAGGCCTGGTGG - Intergenic
1001317094 5:170651326-170651348 CTGTATCAGGGGAAGGCAGGTGG + Intronic
1001773220 5:174311295-174311317 CTGTGTGTGAGGAGGCCCGGGGG + Intergenic
1001898249 5:175399598-175399620 CTCTTTTAGAGCAGGCCTGGTGG - Intergenic
1003417967 6:5929924-5929946 CTGTGTCAGAGAAGTCCACGTGG + Intergenic
1004525414 6:16402781-16402803 CTGTTGCAGAAAAGGCCAGAGGG + Intronic
1004934103 6:20490798-20490820 CTGTTTCCCAGCAGGCCAGGTGG - Exonic
1005049663 6:21673244-21673266 ATGTTTCAGAGAAAGCAAGGAGG + Intergenic
1006584057 6:35094059-35094081 AGGTGTCAGTGGAGGCCAGGTGG + Intergenic
1007422693 6:41729097-41729119 CTGCTGCAGGGGAGGCGAGGCGG - Intronic
1008329427 6:50227482-50227504 CTGTTTTAGGGCAGGCCTGGTGG + Intergenic
1008350071 6:50479458-50479480 CTGTTTTAGGGCAGGCCTGGTGG - Intergenic
1008445614 6:51586662-51586684 ATGTGTCAGAGGAGGGCTGGTGG - Intergenic
1008614649 6:53214728-53214750 CTGTTTCAGGGGAGAACAGTGGG - Intergenic
1008773438 6:55007555-55007577 CTGTTGCAGGGCAGGCCTGGTGG + Intergenic
1009000046 6:57702362-57702384 CTCTTTTAGAGCAGGCCTGGTGG - Intergenic
1009476250 6:64095931-64095953 CTCTTTTAGAGCAGGCCTGGTGG + Intronic
1009582436 6:65553206-65553228 CTGTTTCAGATGAAGCCACTTGG - Intronic
1011192132 6:84740189-84740211 CTCTCTCAGGGTAGGCCAGGTGG - Intronic
1011244620 6:85308994-85309016 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1011296636 6:85833552-85833574 CTCTTTCAGGGCAGGCCTGGTGG + Intergenic
1011317829 6:86055990-86056012 CTGTTTTAGGGCAGGCCTGGTGG + Intergenic
1012583808 6:100898777-100898799 CTGTTTCAAAGGAGCCCCAGGGG - Intergenic
1012653951 6:101792384-101792406 CTCTTTTAGAGCAGGCCTGGTGG + Intronic
1012904638 6:105050178-105050200 CTCTTTCAGGGCAGGCCTGGTGG + Intronic
1013040316 6:106426500-106426522 CTGTTTCAGAGGAGCCCAATTGG - Intergenic
1013154520 6:107480765-107480787 CTATCTCAGAGGATGCCAGCTGG - Intergenic
1014078569 6:117264750-117264772 CTGCTTTCGAGGAGTCCAGGAGG - Intergenic
1014084989 6:117331806-117331828 CTGTTGCAGGGCAGGCCTGGTGG - Intronic
1014120858 6:117723249-117723271 CTGTTTTAGGGCAGGCCTGGTGG - Intergenic
1014145884 6:117997739-117997761 CTGTTTTAGGGCAGGCCTGGTGG - Intronic
1015191569 6:130477467-130477489 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1015260106 6:131227580-131227602 CTGTAGCATAAGAGGCCAGGAGG + Intronic
1016296560 6:142578954-142578976 CTCTTTTAGAGCAGGCCTGGTGG - Intergenic
1016872535 6:148833050-148833072 CTTTTTCTCAGGAGGACAGGGGG - Intronic
1019113329 6:169736490-169736512 CTGTTGCAGAGCAGGCCTGGTGG + Intergenic
1020621999 7:10529573-10529595 CTCTTTCAGGGCAGGCCTGGTGG - Intergenic
1021143447 7:17055650-17055672 CTCTTTCAGATGAGGCAATGGGG - Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1023021420 7:36015128-36015150 CAGTGTCAGAGGAGGCCAAATGG - Intergenic
1023671741 7:42584748-42584770 CTCTTTTAGGGCAGGCCAGGTGG + Intergenic
1025213858 7:57038361-57038383 CTCTTTTAGAGCAGGCCTGGTGG - Intergenic
1025658095 7:63538456-63538478 CTCTTTTAGAGCAGGCCTGGTGG + Intergenic
1025740060 7:64187736-64187758 CTGTTTTTGAGGAGGGGAGGTGG + Intronic
1028933642 7:96441881-96441903 CTGTTCCAGAGGTGGTCAGTGGG + Intergenic
1029544384 7:101202551-101202573 CTGCCTCAGTGGTGGCCAGGTGG - Intergenic
1030079813 7:105767613-105767635 CTGTCTCAGAGGTTGTCAGGAGG - Intronic
1030177919 7:106673698-106673720 CTGTTTTAGGGCAGGCCTGGTGG - Intergenic
1031848313 7:126831821-126831843 CAGTTTCAGAGGAGCCAAGATGG - Intronic
1032689093 7:134265002-134265024 CTGTTTGAGAGCAGGACTGGGGG - Intergenic
1032965386 7:137091418-137091440 TAGTTTAGGAGGAGGCCAGGTGG - Intergenic
1034506686 7:151497813-151497835 AAGGTTCAGAGGAGACCAGGAGG - Intronic
1035533095 8:370747-370769 CTCTTTCAGGGCAGGCCTGGTGG + Intergenic
1036914706 8:12793766-12793788 CTGTTTCAGAGGCTGCAAGCTGG - Intergenic
1037390316 8:18386341-18386363 CTGGTTCAGAGGTGGCCATGTGG + Intergenic
1038381319 8:27097163-27097185 CTGTTGGAGAGGGGGCCTGGGGG - Intergenic
1039099630 8:33927394-33927416 ATGTTTCAGGGGGGCCCAGGAGG + Intergenic
1039767811 8:40648889-40648911 CTGTTTTAGGGCAGGCCTGGTGG - Intronic
1040612547 8:48999550-48999572 CTCTTTCAGGGCAGGCCTGGTGG - Intergenic
1041018132 8:53611334-53611356 CTCTTTTAGAGCAGGCCTGGTGG - Intergenic
1041587157 8:59534706-59534728 CTGTTTTAGGGCAGGCCTGGTGG + Intergenic
1042797790 8:72683733-72683755 CTGCTACAGAGGAGGCTAAGTGG + Intronic
1044162992 8:88944253-88944275 CTGTATCAGAAGAGGCCTGAAGG - Intergenic
1044183168 8:89220141-89220163 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1044712051 8:95067733-95067755 TGGTGTCAGAGGAGGCCAAGTGG - Intronic
1045459468 8:102413020-102413042 GTGTCCCAGAGGAGGCGAGGAGG + Intergenic
1045775069 8:105793262-105793284 CTGTTTTAGGGCAGGCCTGGTGG + Intronic
1047124526 8:121945950-121945972 CTTTATAAGAGGAGGGCAGGAGG - Intergenic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1047888561 8:129280470-129280492 CTGCTTCAAAGAAGCCCAGGGGG - Intergenic
1048118265 8:131549609-131549631 CTCTTTCAGGGCAGGCCTGGTGG + Intergenic
1049041411 8:140114746-140114768 CTGTTTCCGAGGAGGCTTTGCGG - Intronic
1049236183 8:141513496-141513518 CAGGTACAGAGCAGGCCAGGTGG + Intergenic
1049372531 8:142274640-142274662 CTGGTTCAGAGGAGGCCTGTGGG + Intronic
1049623893 8:143611575-143611597 CAGTCTCAGGGGAGGCCTGGAGG + Intergenic
1049920708 9:361180-361202 CTGTGACAGAGGAAGGCAGGGGG + Intronic
1050688893 9:8203151-8203173 CTGTTTTAGGGCAGGCCTGGTGG + Intergenic
1050824879 9:9933042-9933064 CTGTTTTAGGGCAGGCCTGGTGG - Intronic
1051082071 9:13305711-13305733 CTCTTTTAGGGCAGGCCAGGTGG + Intergenic
1051306771 9:15718213-15718235 CTGTGGCAGTGGTGGCCAGGGGG + Intronic
1052726014 9:32229209-32229231 CTCTTTTAGAGCAGGCCTGGTGG + Intergenic
1053273931 9:36769378-36769400 CTGTTGGAGAGATGGCCAGGTGG + Intergenic
1055558812 9:77502503-77502525 AGGTCTCAGTGGAGGCCAGGGGG - Intronic
1055866293 9:80817806-80817828 CTCTTTTAGAGCAGGCCTGGTGG - Intergenic
1056582714 9:87904056-87904078 CTCTTTCAGGGCAGGCCTGGTGG - Intergenic
1057569564 9:96194088-96194110 CAGTGTCAGAGGAGGCCATGAGG + Intergenic
1058002492 9:99880349-99880371 CAGATTCAGAGGAGTCCAGTGGG - Intergenic
1058134601 9:101292769-101292791 CTCTTTTAGAGCAGGCCTGGTGG - Intronic
1058374510 9:104306882-104306904 CTCTTGCAGAGCAGGCCTGGTGG - Intergenic
1059619372 9:115986639-115986661 CAGTTCCAGAGAAGGCCATGAGG + Intergenic
1059746016 9:117202515-117202537 CTGTTGCAGGGCAGGCCTGGTGG + Intronic
1060418165 9:123447615-123447637 CAGAGTTAGAGGAGGCCAGGTGG + Intronic
1060714823 9:125915690-125915712 CAGCATCAGAGGAGCCCAGGAGG + Exonic
1062665014 9:137665819-137665841 CAGCTTCCGAGGAGGCCTGGAGG + Intronic
1185673161 X:1827307-1827329 CTGTTACAGGTGAGGCCAGGTGG - Intergenic
1185980649 X:4774420-4774442 CTATTCAGGAGGAGGCCAGGGGG - Intergenic
1187619629 X:21036945-21036967 GTGTTGCAGATGAGGCCTGGTGG - Intergenic
1188037715 X:25337603-25337625 CTCTTGCAGAGCAGGCCTGGTGG + Intergenic
1188270939 X:28139681-28139703 TTGTGTCAGAGGAGGCCTAGTGG - Intergenic
1189375937 X:40466424-40466446 CCCCTTCAGTGGAGGCCAGGGGG + Intergenic
1191158123 X:57297418-57297440 CTCTTTCAGGGCAGGCCTGGTGG - Intronic
1191804703 X:65122350-65122372 CTCTTTCAGGGCAGGCCTGGTGG - Intergenic
1192071421 X:67944486-67944508 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1192136353 X:68604210-68604232 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1192224528 X:69219231-69219253 CTGTGGGAAAGGAGGCCAGGAGG - Intergenic
1192972970 X:76253075-76253097 TTGTTGCAGATGAGGCCTGGTGG + Intergenic
1193177382 X:78410583-78410605 CTCTTTTAGAGCAGGCCTGGTGG - Intergenic
1194303733 X:92217017-92217039 CTCTTTTAGAGAAGGCCTGGTGG - Intronic
1194609583 X:96024704-96024726 CTTTTTCAGTGGAGGATAGGAGG + Intergenic
1195847768 X:109247177-109247199 CTCTTTTAGAGCAGGCCTGGTGG + Intergenic
1196474587 X:116068073-116068095 CTCTTTTAGGGGAGGCCTGGTGG + Intergenic
1196638673 X:118033555-118033577 CTGTTTTAGGGCAGGCCTGGTGG - Intronic
1198379608 X:136071486-136071508 CTATTTCAGAAGAGGTAAGGGGG + Intergenic
1198856047 X:141017940-141017962 CTCTTTCAGGGCAGGCCTGGTGG + Intergenic
1198876085 X:141228171-141228193 CTCTTTCAGGGCAGGCCTGGTGG - Intergenic
1198906644 X:141569427-141569449 CTCTTTCAGGGCAGGCCTGGTGG - Intergenic
1198916940 X:141683100-141683122 CTCTTTCAGGGCAGGCCTGGTGG - Intronic
1200357800 X:155569800-155569822 CTGTTTTAGGGCAGGCCTGGTGG - Intronic
1200689508 Y:6292937-6292959 CTCTTTTAGAGCAGGCCTGGTGG + Intergenic
1200903490 Y:8457571-8457593 CTCTTTTAGGGGAGGCCTGGTGG + Intergenic
1200954017 Y:8927464-8927486 CTGTCCCAGAGAAGGCCAGGGGG + Intergenic
1200986483 Y:9306798-9306820 CTGTCCCAGAGAAGGCCAGGGGG - Intergenic
1201045764 Y:9881783-9881805 CTCTTTTAGAGCAGGCCTGGTGG - Intergenic
1201248816 Y:12034782-12034804 CTCTTTTAGAGCAGGCCTGGTGG + Intergenic
1201258786 Y:12136812-12136834 CTGTTTTAGGGCAGGCCTGGTGG - Intergenic
1202124096 Y:21554104-21554126 CTGTCCCAGAGAAGGCCAGGGGG + Intergenic
1202154912 Y:21875276-21875298 CTGTCCCAGAGAAGGCCAGGGGG - Intergenic