ID: 1176075853

View in Genome Browser
Species Human (GRCh38)
Location 20:63247920-63247942
Sequence CCCCACCATGGCTGGAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176075853_1176075858 -8 Left 1176075853 20:63247920-63247942 CCAGGGCTCCAGCCATGGTGGGG 0: 1
1: 0
2: 1
3: 35
4: 362
Right 1176075858 20:63247935-63247957 TGGTGGGGAAAGGAATACCAAGG 0: 1
1: 0
2: 1
3: 24
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176075853 Original CRISPR CCCCACCATGGCTGGAGCCC TGG (reversed) Intronic
900138241 1:1127869-1127891 CTCCACCGTGGCTGGAGACAAGG + Intergenic
900313373 1:2045314-2045336 CACCAGGATGGCTTGAGCCCAGG + Intergenic
900571587 1:3361281-3361303 CCCCAACAGGGCTGGAGACGGGG + Intronic
900611447 1:3546269-3546291 CCCCACCATGGCTGGCAGGCTGG - Intronic
900971880 1:5996364-5996386 ACCCACCATGGGATGAGCCCTGG + Intronic
901441576 1:9281492-9281514 CCCCGCCAGGCCAGGAGCCCTGG - Intergenic
901808752 1:11753808-11753830 CCCGTCCATGGCTGAAGTCCTGG - Intronic
902217825 1:14945549-14945571 CCCCACCCCGGCTGGCTCCCCGG + Intronic
902555898 1:17246379-17246401 CCCCAGCAGGGCTGGTTCCCAGG + Intergenic
903187898 1:21639720-21639742 ATCCACCCTGGCTGGACCCCAGG + Intronic
903193506 1:21669222-21669244 CCCCGCCAGGGCTGCGGCCCTGG - Intronic
903213998 1:21833183-21833205 TGCCATCATGGCAGGAGCCCTGG - Intronic
903672248 1:25043333-25043355 CCCAACCATGGCTGCGGACCCGG - Intergenic
903737394 1:25538709-25538731 CCCCATCCTAGCTGGGGCCCAGG - Intergenic
904629556 1:31830670-31830692 AGCCACCTTGGCTGCAGCCCAGG - Intergenic
905287665 1:36893531-36893553 CCGCACCAAAGCTGGAGCCATGG - Intronic
905657015 1:39691784-39691806 CCCCACCCATGCTGGGGCCCAGG - Intergenic
906003246 1:42445457-42445479 CCCAACCTGGTCTGGAGCCCTGG + Intronic
907269086 1:53280132-53280154 CCCCAGCATTGCTGGCGCCCTGG + Intronic
907296880 1:53461130-53461152 CCCGGCCATGGCTCAAGCCCTGG - Intronic
907614693 1:55912476-55912498 CCCAGCCATGGCTGCAGACCTGG + Intergenic
911040749 1:93589014-93589036 CCTCACCATGGGTGGCGTCCAGG - Exonic
911055179 1:93702531-93702553 CCCCACCTGGGCCTGAGCCCAGG - Intronic
913594371 1:120359223-120359245 CCCTTCCTTGGCTGGGGCCCTGG - Intergenic
914092889 1:144519761-144519783 CCCTTCCTTGGCTGGGGCCCTGG + Intergenic
914305638 1:146414112-146414134 CCCTTCCTTGGCTGGGGCCCTGG - Intergenic
914596418 1:149158694-149158716 CCCTTCCTTGGCTGGGGCCCTGG + Intergenic
914703713 1:150154827-150154849 ACCCTCCGTGGCTTGAGCCCAGG - Intronic
914815471 1:151059363-151059385 CCCCAGCATCTCTGCAGCCCAGG + Exonic
915482004 1:156193324-156193346 CCGCAGCATCGCTTGAGCCCAGG + Intergenic
915927828 1:160037725-160037747 CCTCTCCATGGCTGCTGCCCTGG - Exonic
917201787 1:172525013-172525035 CACGACAATCGCTGGAGCCCAGG - Intergenic
919083379 1:192892001-192892023 CCAAACCATGGCTGCAGACCTGG - Intergenic
920357102 1:205381940-205381962 CCCCACCATGACTGCACCCTTGG - Intronic
920928324 1:210363659-210363681 CCCCACCATGACCTGGGCCCTGG - Intronic
921033502 1:211354320-211354342 CTAGAGCATGGCTGGAGCCCTGG + Intronic
921665580 1:217866937-217866959 CCCCACACTGCCTGGAGTCCTGG + Intronic
923535855 1:234851298-234851320 CCAAAGGATGGCTGGAGCCCAGG + Intergenic
924679813 1:246220371-246220393 CCAAACCATGGCTGCAGACCTGG + Intronic
1062923577 10:1297858-1297880 CCCAGCCATGGCTGGAGGCCAGG + Intronic
1063187572 10:3665009-3665031 TGCCACCACTGCTGGAGCCCAGG + Intergenic
1063521916 10:6748863-6748885 CCCAACTCTGGCTGGAGCCAGGG + Intergenic
1063623081 10:7666948-7666970 TCCCGCAGTGGCTGGAGCCCTGG - Exonic
1064342292 10:14498398-14498420 CTCCCCCATGGCAGGAGCCCTGG + Intergenic
1067525294 10:47034969-47034991 CCCCACCAGGGCAGGTGCTCCGG - Intergenic
1067699001 10:48555423-48555445 CCCCACCAGGGCTGCAGAGCTGG + Intronic
1067769830 10:49115345-49115367 CCCCACCAGGCCCGGAGCCCCGG + Intronic
1068877259 10:62010085-62010107 CCCCATCATGGTTAGAACCCAGG + Intronic
1069638221 10:69938373-69938395 CACCACCCTCCCTGGAGCCCGGG + Intronic
1069659910 10:70116817-70116839 CCCCATCAAGCCTGGACCCCAGG + Intronic
1071603513 10:86970316-86970338 CCCCATCCCGGCTGGGGCCCAGG + Intronic
1072913296 10:99522087-99522109 CCCCAGCGAGGCTGGAGTCCGGG - Intergenic
1073326024 10:102644338-102644360 CCCCTCCAAGGCTGGAGTCCCGG + Intergenic
1073429852 10:103479029-103479051 ACCCACCCAGGCTGGAGCCATGG - Exonic
1075060489 10:119253557-119253579 CCCCACCACGGCTGGAACCAGGG + Intronic
1075679425 10:124321864-124321886 CCCAACCATGGCTGGCGCGGTGG + Intergenic
1076065457 10:127444480-127444502 CCCCTCCAGTGCTGGAGACCTGG - Intronic
1076133669 10:128030203-128030225 CCGCAGCATGGCTGCTGCCCTGG + Intronic
1076434457 10:130430602-130430624 CTTCCCCATGGCTGGTGCCCTGG - Intergenic
1076499470 10:130924814-130924836 CCTGACCATGGCTGGAGCCTGGG + Intergenic
1076635792 10:131881040-131881062 CCACACCATGCTTTGAGCCCTGG + Intergenic
1077049714 11:561184-561206 CCCCAGCCTGGCGGGAGCCAGGG - Exonic
1077144604 11:1039350-1039372 CCCCACCAGGGCTCGGGGCCAGG - Intergenic
1077284572 11:1759939-1759961 CCCCACCCTGGCTTGACCTCTGG - Intronic
1078542735 11:12224576-12224598 TGCCACCATGGCTGGGGACCAGG - Intronic
1080542416 11:33280648-33280670 CCAAACCCTGGTTGGAGCCCTGG + Intronic
1081703158 11:45164511-45164533 CCTCACGGTGGCTGGCGCCCTGG - Intronic
1081989069 11:47327904-47327926 CCCCTGCATGGCTGGAGCGGGGG + Intronic
1082761470 11:57131003-57131025 CCGCCCCTTGCCTGGAGCCCAGG + Intergenic
1083235656 11:61349251-61349273 CCCCACCATGGCTGCTTGCCTGG - Exonic
1083302945 11:61748303-61748325 CCACACCCTGGCTGCAGCCCCGG - Intergenic
1083821285 11:65172725-65172747 CCCCACCATGGTGGGGGCGCCGG - Exonic
1084146893 11:67269779-67269801 CCCCTCCATGGCTGGTGCCTGGG + Intronic
1084150857 11:67287328-67287350 CCACACCAATGCTGGAGGCCTGG - Intergenic
1084275207 11:68047811-68047833 CCCCAGCCGGGCTGGGGCCCGGG - Intronic
1084694364 11:70744883-70744905 CCCCACCAAGGCTTGAGTCCAGG + Intronic
1084954901 11:72685907-72685929 CCCCACCAAGGCTGGAGGGAGGG + Intronic
1085272348 11:75277801-75277823 CCAAGCCAGGGCTGGAGCCCAGG - Intronic
1085309914 11:75510173-75510195 CCCCAGCAGGGCTGGGGCCATGG - Intronic
1085440047 11:76552798-76552820 CACCACCATCGCTCCAGCCCTGG + Exonic
1088533615 11:110836998-110837020 CCCCACCATGACTATACCCCTGG + Intergenic
1088815610 11:113418825-113418847 CCCCAACAGGGCTGTAGCCTGGG + Intronic
1089288036 11:117420167-117420189 CCCCATGGTGGCTGGAGGCCTGG + Intergenic
1090836639 11:130458837-130458859 ACCCAGCAAGGCTGGAGCTCTGG - Intronic
1090913346 11:131141081-131141103 CCCCACCCTGGCAGGTCCCCTGG - Intergenic
1091736673 12:2928243-2928265 AGCCACCATGGCTGGCCCCCTGG - Intronic
1092197160 12:6556260-6556282 CGCCACCCCGGCTGGAGTCCAGG - Intergenic
1096551841 12:52378222-52378244 CCCCAGCCTGGGTGGAGCCCGGG - Exonic
1096587787 12:52634357-52634379 CATCATCATGGCTGGAGGCCGGG - Intergenic
1096627562 12:52904813-52904835 CCCCACCATAGCCGCCGCCCAGG + Exonic
1096790733 12:54043185-54043207 CCCCAGCATGCCTGGAGCAGTGG - Intronic
1096969146 12:55651560-55651582 TCCAACCATGGCTGGGGCCGAGG + Intergenic
1097198823 12:57260810-57260832 TCCCAGCATGACTGGTGCCCAGG - Intronic
1101977228 12:109370216-109370238 CCCCTCCCTGGCTGAAGCCAGGG + Intronic
1101988436 12:109465489-109465511 CCACACCCTGGCTGGGACCCAGG + Intronic
1103173563 12:118843294-118843316 CCCAGCCATGGCTGCAGACCCGG + Intergenic
1104492681 12:129208621-129208643 CCTAGCCATGGCTGGAGCACAGG - Intronic
1104842251 12:131830723-131830745 ACCCAGCAGGGCTGGAGCCGGGG + Intronic
1110739853 13:78981881-78981903 ACCCACTATTGCTGGAGCACTGG + Intergenic
1111243638 13:85507871-85507893 CCCAACCATGGCTCCAGACCCGG + Intergenic
1111512803 13:89287857-89287879 CCAAACCATGGCTGCAGACCTGG - Intergenic
1112228983 13:97568938-97568960 CACCACCATGGCTGCAGTCCAGG - Intergenic
1113471348 13:110548939-110548961 CCCTTACCTGGCTGGAGCCCTGG - Intronic
1113711709 13:112469515-112469537 CACCACCCTGGCAGGAGCACGGG + Intergenic
1115502931 14:34065300-34065322 ATCCACCATGGCTGGAGACGTGG - Intronic
1118883829 14:69850457-69850479 CCCCGCCATGGCTGGGTCTCTGG + Intergenic
1119406773 14:74403861-74403883 CACCAGCCTGGCTGGGGCCCCGG - Intergenic
1119644432 14:76338267-76338289 GCCCACCCGGGCTGGAGCCAGGG - Intronic
1119677435 14:76566373-76566395 CCCCAGCATGACTGCACCCCAGG - Intergenic
1121019472 14:90570368-90570390 CTGCACCAAGGCAGGAGCCCTGG + Intronic
1121090293 14:91176690-91176712 CACCTCCCTCGCTGGAGCCCAGG - Intronic
1121114713 14:91335531-91335553 CCCAAACATGGCTGGGGCCAGGG - Intronic
1121486854 14:94323033-94323055 CCCCTGCATGGCAGGAACCCAGG + Intronic
1122276547 14:100593696-100593718 CCCCACCATTCCAGGGGCCCTGG - Intergenic
1122455152 14:101844433-101844455 CCCCTGCAAGGCTGGAGCTCCGG + Intronic
1122550189 14:102545167-102545189 CCCCATCAGGGCTGGAGACAGGG - Intergenic
1122901573 14:104784330-104784352 ACCTCCCATGCCTGGAGCCCTGG - Intronic
1122923061 14:104887863-104887885 GCCCACCATGGCCGAAGCACGGG + Exonic
1122945376 14:105006222-105006244 TCCCACCTTGGCTGGTGGCCTGG - Intronic
1122985019 14:105208058-105208080 CCCCACAATGGCTGGAGGGGAGG - Intergenic
1123024656 14:105419167-105419189 CCCCAACAGGGCTGGAGTCCAGG - Intronic
1202860885 14_GL000225v1_random:80264-80286 CCCCACCACGGAAGGATCCCAGG + Intergenic
1123458679 15:20448070-20448092 TGTCACCAAGGCTGGAGCCCAGG + Intergenic
1124641666 15:31399862-31399884 GCCCAGCATGGCAGAAGCCCCGG - Intronic
1124661589 15:31554466-31554488 CCCGACCCTGGCTTGAGGCCCGG - Intronic
1125468307 15:39976776-39976798 CCTCGTCATCGCTGGAGCCCGGG - Exonic
1125604511 15:40932360-40932382 CCCCACAATGGCTGTCGCCACGG + Exonic
1125688710 15:41579215-41579237 CCCCACCAAGGCTGGGGTCCAGG - Exonic
1128028992 15:64462539-64462561 CCAGAGGATGGCTGGAGCCCAGG + Intronic
1128234917 15:66060641-66060663 CCCCGCCATGGCTTCAGCCTTGG + Intronic
1128562319 15:68677110-68677132 CCCCGCCAGGCCTGGAGCCCCGG + Intronic
1128567361 15:68710264-68710286 CCCCACCCAGGATGGACCCCTGG - Intronic
1129329951 15:74821937-74821959 CCCCAGCTTGGCTGGTGCTCTGG + Intronic
1129457387 15:75683116-75683138 CCGCAGCAGGACTGGAGCCCTGG - Intronic
1129529889 15:76257174-76257196 CCCCACCAAGGCTGGGGCCCAGG + Intronic
1129664486 15:77571956-77571978 CACCACGATGGCAGAAGCCCGGG - Intergenic
1129673857 15:77621947-77621969 CCCCACGAAGGCTGGGGCCCAGG + Intronic
1129726404 15:77903829-77903851 CCACAGCAGGACTGGAGCCCTGG + Intergenic
1130550344 15:84886581-84886603 CCCCACCCTGGCTGTGGCCCTGG + Intronic
1130895416 15:88166538-88166560 CAGCACCATGGCCAGAGCCCAGG - Intronic
1132207311 15:99995044-99995066 GCCCACCATGGACGGACCCCTGG - Intronic
1132469779 16:95951-95973 ACCCACCAGGGCTGGGCCCCAGG + Intronic
1132942599 16:2515346-2515368 CCCCACCCTGCCTGGTGGCCTGG + Intronic
1133169229 16:3970782-3970804 CCCCATCCTGGCTGGACCGCGGG + Intronic
1133382371 16:5341911-5341933 CCCTGCCAGGGCTGGAGCCATGG + Intergenic
1134429599 16:14190801-14190823 CCACACAATGACAGGAGCCCAGG - Intronic
1134516827 16:14894325-14894347 CCACACCCTGGCTGGACCCTAGG - Intronic
1134704498 16:16292979-16293001 CCACACCCTGGCTGGACCCTAGG - Intronic
1134963044 16:18419135-18419157 CCACACCCTGGCTGGACCCTAGG + Intronic
1134967339 16:18501734-18501756 CCACACCCTGGCTGGACCCTAGG + Intronic
1135818187 16:25655309-25655331 CCACAGCATGCCTGGGGCCCAGG - Intergenic
1136414484 16:30095360-30095382 CCGCACCATGGCGGGGGCCGGGG + Exonic
1138270457 16:55692243-55692265 CCCACCCATGTCTGGAGGCCTGG + Intronic
1140411524 16:74743800-74743822 CCCCTCCTTGGCAGAAGCCCAGG + Intronic
1141137356 16:81474841-81474863 GCCCCCCATGGCTGGAGGCAGGG - Intronic
1141512214 16:84519730-84519752 CAACACCAGGGCTGGAACCCCGG + Intronic
1141774141 16:86111032-86111054 GCCCAGCATGGCTGGGGACCCGG + Intergenic
1142001438 16:87666623-87666645 CCCCTCTCTGGCTTGAGCCCAGG - Intronic
1142415146 16:89937019-89937041 CCCCAACATGGATGGGGCCGGGG + Intergenic
1142713710 17:1736821-1736843 CCCCAGCTTGGCTGGAGGCCAGG + Intronic
1142978189 17:3657370-3657392 CCCCACCAAGGCTGGGTCCGGGG + Intronic
1143658803 17:8312432-8312454 GCTCCCCATGGCTGGAGTCCTGG + Exonic
1144782173 17:17813798-17813820 CCCTCCCAGAGCTGGAGCCCTGG - Intronic
1146425206 17:32731860-32731882 CCCAGCCATGGCTGTAGACCTGG + Intronic
1146463397 17:33066044-33066066 TCCCACCATGGCGGGACACCTGG + Intronic
1146536699 17:33658706-33658728 CCCCACCTTGGCTGGAGCTGCGG + Intronic
1147167397 17:38600858-38600880 CCCCAGCATGGCTGGAACACAGG + Intronic
1147268047 17:39246768-39246790 CCCCACCATTCCTGGGACCCAGG + Intergenic
1147422799 17:40331017-40331039 CCCCACCCTAGCTGGGGGCCAGG - Exonic
1147612915 17:41812116-41812138 CACCCCCAAGGCAGGAGCCCGGG - Exonic
1147767169 17:42844923-42844945 GCCCCCCAAGGCTGCAGCCCTGG + Exonic
1148182011 17:45612955-45612977 CACGACAATCGCTGGAGCCCAGG - Intergenic
1148266848 17:46232744-46232766 CACGACAATCGCTGGAGCCCAGG + Intergenic
1148563463 17:48619502-48619524 CCCCGCCAGGCCGGGAGCCCCGG + Intronic
1148770547 17:50063660-50063682 CCTCAGCATAGCTGGAGTCCAGG - Intronic
1149685411 17:58531955-58531977 CCTTACCATGGCTGCAGCCCGGG + Intronic
1150201631 17:63362827-63362849 CCCAGCCATGGCTGCAGACCTGG - Intronic
1151357894 17:73571289-73571311 GCCCACCATGCCTGGGGCTCAGG - Intronic
1151820878 17:76496144-76496166 CCCCACCACGGAGGGAGCCAGGG + Intronic
1152008952 17:77699029-77699051 GCCCATCAGGGCTGGTGCCCAGG + Intergenic
1152147163 17:78575272-78575294 CCCCGCCATGGGGGGTGCCCCGG + Intronic
1152379910 17:79937076-79937098 CCCCTCCAAGGGTGGAGCCTTGG + Exonic
1152460239 17:80438667-80438689 CCCCACCCTGCCTGGAGGCTGGG + Intergenic
1152575687 17:81139896-81139918 ACCCACCATGGGTGAGGCCCTGG - Intronic
1152659186 17:81534603-81534625 CCAGCCCCTGGCTGGAGCCCAGG + Intronic
1152737739 17:82005565-82005587 CCCCACCAAGGCTGAGACCCAGG + Intronic
1152812460 17:82388500-82388522 CCCCACCATGGTCACAGCCCTGG - Intergenic
1153146082 18:2034377-2034399 CTCCAACTTGGCTGGAACCCCGG + Intergenic
1156473072 18:37389570-37389592 GCTCACCATGGCTGGACCTCTGG + Intronic
1156844814 18:41652962-41652984 CACCTCCATGGCTGCAACCCTGG + Intergenic
1157328903 18:46689047-46689069 CCCCACCCTGCATGGAGCCGAGG + Intronic
1157328919 18:46689099-46689121 CCCCACCCTGCATGGAGCCGAGG + Intronic
1159132768 18:64298978-64299000 CCCGACAATGACTGGAGCACAGG + Intergenic
1160505731 18:79425982-79426004 CACCAGGATCGCTGGAGCCCAGG + Intronic
1161577152 19:5060623-5060645 CCCCACCATGCCTGGACCCACGG - Intronic
1161977692 19:7615492-7615514 CTCCTCCTCGGCTGGAGCCCGGG - Exonic
1162349692 19:10141131-10141153 CCCAACCATGCCCGTAGCCCTGG - Exonic
1163361078 19:16846791-16846813 GCCCAGCATGGCCTGAGCCCCGG - Intronic
1165213599 19:34254334-34254356 CCCCACCATGGCTTGGCCCCCGG - Intergenic
1166197939 19:41219126-41219148 GCCCACCAGGGCCAGAGCCCAGG - Intergenic
1166772895 19:45294939-45294961 CCCCACCAGGGCTGTAGGGCAGG + Intronic
1166849160 19:45750059-45750081 CCCCACGTTGTCTTGAGCCCTGG - Intronic
1166849199 19:45750294-45750316 CCCCACATTGTCTTGAGCCCTGG + Intronic
1167117747 19:47497977-47497999 CCCAACCATGGCTGCTGCTCAGG - Intronic
1168352093 19:55681897-55681919 CTCAACCATGCTTGGAGCCCAGG - Intronic
1168644978 19:58053907-58053929 CCCACCCAGGGATGGAGCCCAGG + Exonic
1168687632 19:58358123-58358145 CTCCACCCTGGCCGGATCCCTGG + Intronic
925603059 2:5628577-5628599 CCCTTCCTTGGCTGGGGCCCTGG - Intergenic
927147877 2:20178826-20178848 CACCACCATGGCTGAGACCCAGG - Intergenic
927864900 2:26582081-26582103 CAGCACCAGGGCAGGAGCCCGGG - Intronic
928411875 2:31060655-31060677 CTGCACCATGGCTGGGCCCCTGG - Intronic
929893216 2:45936328-45936350 TCCCAGCATGGCTGGGGCACGGG - Intronic
931835986 2:66098657-66098679 ACCCACCATGGATGTGGCCCTGG + Intergenic
932494246 2:72138647-72138669 CCCCACCACGGCTGGTGCCAGGG + Intronic
932622318 2:73272152-73272174 TCCCACCATCCCTGGAGCTCAGG + Intronic
932779018 2:74548752-74548774 CTCCACCTGCGCTGGAGCCCTGG - Intronic
935363442 2:102267066-102267088 GCATGCCATGGCTGGAGCCCTGG - Intergenic
935534220 2:104274146-104274168 CCCCATCCTGGCTGGAAGCCCGG + Intergenic
937386434 2:121437849-121437871 CCTAAGCATGGCAGGAGCCCTGG - Intronic
938138829 2:128780493-128780515 CCCCACAATAGCTGGACCCAAGG + Intergenic
938369826 2:130762149-130762171 CCCCTCCCTGGCTGCAGCCACGG - Exonic
941490446 2:166137104-166137126 CCCAACAAATGCTGGAGCCCTGG - Intergenic
946438935 2:219678931-219678953 GCCCACCATGGCAGGAGGGCAGG - Intergenic
947874844 2:233461236-233461258 CCGCACGCTGGCTGGTGCCCTGG + Intronic
948429274 2:237908954-237908976 TCCTACCCTGGCTGCAGCCCTGG + Intronic
948461600 2:238132416-238132438 CCCCAGCAAGGCTGGAGAGCAGG + Exonic
948573789 2:238936807-238936829 CCCCATCAGCGCTTGAGCCCTGG - Intergenic
948797061 2:240410869-240410891 CCCCACCATGGCAGGTGCAAGGG + Intergenic
948797072 2:240410899-240410921 CCCCACCATGGCAGGTGCGAGGG + Intergenic
948797093 2:240410958-240410980 CCCCACCATGGCAGGTGCGAGGG + Intergenic
948803265 2:240442248-240442270 CCCCACCCTGTGTGGAGCTCAGG - Intronic
1171458357 20:25284327-25284349 CCCCACCATGACAGAGGCCCAGG - Intronic
1171517666 20:25750660-25750682 CCCCACCCAGGCTGGTTCCCAGG - Intergenic
1172910121 20:38402396-38402418 CCCCAGCATGGCGGGAACCTGGG - Intergenic
1173068271 20:39736115-39736137 CCCCAACATGTCTGGGGCCAGGG + Intergenic
1173840026 20:46151150-46151172 CCCCACCTTGGGTGAAGGCCAGG + Intergenic
1175154560 20:56961329-56961351 TCCCAGGATGGCTTGAGCCCAGG + Intergenic
1175407569 20:58744918-58744940 CCCCACCATGTGTGGATCCAGGG + Intergenic
1175426053 20:58867755-58867777 CCTGACCATGGCAGGACCCCAGG - Intronic
1175527908 20:59648271-59648293 CCTCAAAATGGCTGGAGCCTGGG - Intronic
1175753465 20:61514879-61514901 CCACCCCATGGCTGCCGCCCAGG - Intronic
1175990591 20:62786573-62786595 CCCCACCCTGCTGGGAGCCCAGG + Intergenic
1176044995 20:63087959-63087981 CCCGACGGTGACTGGAGCCCAGG - Intergenic
1176075853 20:63247920-63247942 CCCCACCATGGCTGGAGCCCTGG - Intronic
1178995293 21:37393808-37393830 CCCTTCCATGCCTGGTGCCCTGG + Intronic
1179950798 21:44707915-44707937 CCCCACCCTTCCCGGAGCCCTGG + Intronic
1180004010 21:45011619-45011641 CCCGACCCTGCCTGGAACCCTGG + Intergenic
1180007895 21:45031693-45031715 CCCCGCCCTGGCTGGAGCTGAGG - Intergenic
1180844385 22:18973333-18973355 CCCCACAGGGGCTGGGGCCCTGG + Intergenic
1180858641 22:19064153-19064175 TCCCCGCATGGCAGGAGCCCAGG + Intronic
1180931180 22:19592997-19593019 CCCCACCAAGGCAGAAACCCAGG - Intergenic
1181266774 22:21635221-21635243 CCCCTCCATGTCTAGTGCCCAGG + Exonic
1181474362 22:23159263-23159285 CCCCACCATGGTGACAGCCCTGG - Intronic
1182145704 22:27995538-27995560 CCCCAACATCTGTGGAGCCCAGG - Intronic
1182280638 22:29216113-29216135 CCCTCCCATCCCTGGAGCCCAGG - Intronic
1182353024 22:29709472-29709494 CCCCACCTTGTCAGGAGGCCAGG + Intergenic
1182832872 22:33317871-33317893 CTCCACCATGACTGGAGCGATGG + Intronic
1183432497 22:37774248-37774270 CCCCGCCATGGCTGCTGCCTGGG - Exonic
1183520494 22:38293829-38293851 GCCCACCCTGGCTGGGCCCCTGG + Intronic
1183549184 22:38471291-38471313 CCCCACCAGGGCTGCCTCCCAGG + Intronic
1183590903 22:38778851-38778873 CCCCACCAAGGCTGGGGGCTGGG + Exonic
1184024928 22:41848512-41848534 CCCCACCCTTGCTGCAGCCAGGG - Intronic
1184031481 22:41897456-41897478 CCCCACCATCCCTGGTGCCTGGG - Intronic
1184149390 22:42629565-42629587 CCCCAGCAAGGAAGGAGCCCGGG + Intronic
1184192942 22:42907145-42907167 GCTCAGCTTGGCTGGAGCCCAGG + Intronic
1184404757 22:44293490-44293512 CCCCACCATGGAGGGTGACCTGG + Intronic
1184688805 22:46108285-46108307 CCCCAGCATGCCCGCAGCCCGGG - Intronic
1185153103 22:49177800-49177822 ACCCACCATGCCTGGTGCACAGG + Intergenic
949244720 3:1913661-1913683 CCCCACCATGGGACAAGCCCTGG + Intergenic
950170440 3:10835306-10835328 CCACCCCATGGCTGGGGTCCAGG - Intronic
950691258 3:14659934-14659956 GCCTAGCATGGCTGGGGCCCAGG + Intronic
951120102 3:18916623-18916645 CTCCACAATGTCTGGAACCCAGG - Intergenic
953325318 3:42007923-42007945 GCCCTCGATGGCTGGAGCCATGG - Intergenic
953463235 3:43097926-43097948 CCTCACCATGGCCTGTGCCCGGG + Intronic
954406059 3:50345603-50345625 CCCCACCCCGGCTGCTGCCCAGG - Exonic
954423706 3:50432272-50432294 ACCCTCCATGCGTGGAGCCCAGG - Intronic
954663329 3:52237598-52237620 CTCCACCAGGGCTGGAGGCTGGG + Intronic
955688121 3:61564436-61564458 CCCCACGAAGGCTGGTTCCCTGG - Intronic
956161942 3:66364410-66364432 CCCCAGCATCACTGGAGCACCGG - Intronic
960946986 3:122973763-122973785 ACCCACCAAGTGTGGAGCCCAGG + Intronic
961182361 3:124886985-124887007 CCCCACCATGCCGCGGGCCCCGG - Exonic
961824598 3:129592487-129592509 CCCCACCCTGGCTGGATGTCAGG - Intronic
963796039 3:149631848-149631870 CCCTACCAAGCATGGAGCCCAGG - Intronic
965408333 3:168298769-168298791 CCCAGCCATTGCTCGAGCCCAGG - Intergenic
965648355 3:170908374-170908396 CCCCACTAGGGCCTGAGCCCCGG + Intronic
967488318 3:190059470-190059492 TGACACTATGGCTGGAGCCCAGG - Intronic
968413244 4:406926-406948 CCTCAGCATGCCTGTAGCCCAGG - Intergenic
968753642 4:2403213-2403235 CCCCTCCTGGGCTGTAGCCCTGG - Intronic
969214847 4:5713177-5713199 CCCCTCCATGGCTGCCACCCTGG - Intronic
969445475 4:7242567-7242589 CTCCACCTTGGCTGGACACCTGG + Intronic
969681419 4:8645419-8645441 CCCCACCATGGCTGAAGACATGG - Intergenic
970727137 4:19060179-19060201 GCCTACCATGACTGGGGCCCTGG + Intergenic
971534874 4:27736190-27736212 TCCACCCATGACTGGAGCCCAGG - Intergenic
974514908 4:62896969-62896991 CCCAACCATGGCTTCAGACCCGG + Intergenic
976477326 4:85499574-85499596 CCCCACCAAGGCTGCAGGCTAGG - Intronic
979843620 4:125479006-125479028 GCCCAACATGGTTGGAGCTCAGG - Intronic
981142960 4:141291733-141291755 CCGCACCATGCCTGCTGCCCAGG - Intergenic
985551327 5:534959-534981 CCCTGCCAGGGCTGGAGCCAGGG - Intergenic
985666974 5:1186435-1186457 ACCCACCAGGGCAGGAGGCCGGG - Intergenic
986233317 5:5886043-5886065 CCCCAGCATCGCTGGCTCCCAGG + Intergenic
986487089 5:8248666-8248688 CCCTGCCATGGCTGGAGCTTAGG + Intergenic
986753506 5:10812084-10812106 TCCCACCATGCCAGGATCCCTGG - Intergenic
990745064 5:58950683-58950705 CCACACCATGCCTGATGCCCAGG + Intergenic
991090380 5:62688701-62688723 AGCCACCATGCCTGGACCCCGGG + Intergenic
992887213 5:81170489-81170511 GCCCAGTATGGCTGCAGCCCAGG - Intronic
994132010 5:96240654-96240676 CACCACAATTGCTTGAGCCCAGG - Intergenic
997643373 5:135464308-135464330 TCGCAGCATGGCTGGAGCACGGG - Intergenic
998141039 5:139699647-139699669 ACCCACTCTGGCTAGAGCCCAGG - Intergenic
999287943 5:150405308-150405330 TCCCATCATGGCTGAAGTCCAGG - Intronic
999902087 5:156095626-156095648 CCCCTCCAGGGCTGGATCCCTGG + Intronic
1001025890 5:168224268-168224290 CCACCCCATGCCTGGGGCCCTGG + Intronic
1002943910 6:1742785-1742807 CCCCTCTACGGCTGCAGCCCTGG - Intronic
1002984427 6:2174968-2174990 CCCCACAGTGGCTGTAGACCTGG - Intronic
1006445164 6:34076029-34076051 CCACTCCATGGCAGGAGCCGAGG + Intronic
1007176093 6:39898741-39898763 CCACACCAGGGCTGGAACCCAGG + Intronic
1014940873 6:127437066-127437088 CCCCACCGTAGATGGAGCTCAGG + Intergenic
1015405423 6:132831809-132831831 CCCCACTATTTATGGAGCCCAGG - Intergenic
1017613126 6:156213196-156213218 CCACACCATGCCTGTTGCCCAGG - Intergenic
1018414933 6:163592634-163592656 CCCCACCTTGGCTTGACCCCAGG - Intergenic
1019411891 7:910285-910307 CCCCACCCAGGCTGGAGTGCAGG + Intronic
1020080406 7:5283294-5283316 CCCCTCCATGGCGAGGGCCCAGG - Intronic
1022501322 7:30883843-30883865 CAACACCAGGGCTGGAACCCAGG - Intronic
1022925396 7:35051506-35051528 CCCCAGCTTGGCTGCAGCGCAGG + Intergenic
1023940659 7:44766618-44766640 CCCCAGCATGTCTGGAGCCGGGG + Exonic
1024629009 7:51231952-51231974 TCCGACCATGGCAGGAGCTCAGG - Intronic
1025149387 7:56537184-56537206 CCCCACCCAGGCTGGTTCCCAGG - Intergenic
1025198508 7:56948885-56948907 CCCCTCCATGGCCAGGGCCCAGG + Intergenic
1025639755 7:63354865-63354887 CCCCACCCAGGCTGGTTCCCAGG + Intergenic
1025642944 7:63393227-63393249 CCCCACCCAGGCTGGTTCCCAGG - Intergenic
1025673443 7:63628048-63628070 CCCCTCCATGGCCAGGGCCCAGG - Intergenic
1025712874 7:63927861-63927883 CTGGACCAGGGCTGGAGCCCAGG - Intergenic
1025865793 7:65379446-65379468 TCTCACCATGGCAGGAGACCTGG - Intronic
1029973891 7:104815030-104815052 CCAAACCATGGCTGCAGACCTGG - Intronic
1030598243 7:111563915-111563937 CCCAACCTAGGCTGAAGCCCAGG + Intergenic
1032197002 7:129795205-129795227 CCCCACCAGGCCTGGGCCCCTGG + Intergenic
1032374154 7:131392987-131393009 CCGGAACATGGCTTGAGCCCAGG - Intronic
1032691577 7:134293061-134293083 CCACACCATGGAATGAGCCCAGG + Exonic
1032953049 7:136938565-136938587 CCCCACCATAGCCGCTGCCCAGG + Intronic
1035406709 7:158603476-158603498 CCCCAGCTTGACTGGAGCACAGG + Intergenic
1035590704 8:811308-811330 TCTCACCACGGCAGGAGCCCTGG - Intergenic
1035590725 8:811397-811419 TCTCACCACGGCAGGAGCCCTGG - Intergenic
1035590744 8:811486-811508 TCTCACCACGGCAGGAGCCCTGG - Intergenic
1035590765 8:811575-811597 TCTCACCATGGCAGGAGCCCTGG - Intergenic
1035590787 8:811665-811687 TCTCACCACGGCAGGAGCCCTGG - Intergenic
1035590808 8:811754-811776 TCTCACCACGGCAGGAGCCCTGG - Intergenic
1036768222 8:11562473-11562495 CACCTCAATGGCTGCAGCCCCGG - Intronic
1038193088 8:25341858-25341880 CCCCTGCTTGGCTGGAGCCTGGG + Intronic
1040038855 8:42896827-42896849 CGCCGCCCTGGCTGGAGCCGAGG - Intronic
1041095324 8:54343708-54343730 TCCCACCAGAGCTGGAACCCAGG + Intergenic
1042856516 8:73273249-73273271 CCCAGCCATGGCTGCAGACCTGG + Intergenic
1044205291 8:89486275-89486297 GCCCAGCATTGCTGGATCCCAGG + Intergenic
1044238131 8:89855467-89855489 CACAACCATGGCTTGAACCCAGG + Intergenic
1046660944 8:116947926-116947948 CCACACCATGACTGCAGCCAGGG + Intergenic
1049010136 8:139881947-139881969 CCCCACCATGCATGGATGCCAGG + Intronic
1049220752 8:141427746-141427768 CGCCACAAGGACTGGAGCCCTGG - Exonic
1049326679 8:142025136-142025158 GCCCACAATGGCAGCAGCCCTGG + Intergenic
1049395146 8:142396707-142396729 CCCAGCCATGACTTGAGCCCTGG - Intronic
1049602488 8:143514331-143514353 CCCCATCCTGGCTCGGGCCCTGG + Intronic
1049624778 8:143615095-143615117 CCCCACCAAGGCTGGAGGAGGGG + Intronic
1049624867 8:143615393-143615415 ACACGGCATGGCTGGAGCCCTGG + Intronic
1049767772 8:144362871-144362893 CTCCACCAAGCCTGCAGCCCAGG - Intergenic
1051001690 9:12290464-12290486 CCAAACCATGGCTGCAGACCTGG + Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1056357002 9:85810705-85810727 CCACACCAAGGCTGGAGCAGTGG - Intergenic
1056560669 9:87726557-87726579 CCCTGCCACGCCTGGAGCCCTGG + Intronic
1057009532 9:91589441-91589463 CACCATCATGGCAGTAGCCCAGG + Intronic
1057280053 9:93702520-93702542 CCACCGCTTGGCTGGAGCCCAGG - Intergenic
1057712862 9:97462923-97462945 CCACATCAGGGCTGCAGCCCAGG + Intronic
1057807885 9:98233615-98233637 CGCCACCACTGCTGGAGCTCAGG + Intronic
1057824370 9:98360819-98360841 CCCCACCACAGCTGGAGCCTTGG + Intronic
1057888273 9:98847848-98847870 CTCCACCAAGGCTGGAGTGCAGG + Intronic
1058755205 9:108077316-108077338 CCACACCATGCCTGTAGCCCTGG - Intergenic
1060171982 9:121469368-121469390 CCTCAGCATGGCTGGATCCAAGG + Intergenic
1060514410 9:124257193-124257215 CCCCAGGAGGGCTGGAGCCAGGG - Intergenic
1060810621 9:126609937-126609959 CCCCAGCGGGGCTGGACCCCAGG - Intergenic
1060918659 9:127405676-127405698 CCCCACCATGCCTGGGCCACTGG + Intronic
1061399957 9:130362887-130362909 CCTCACCTTGGCTAGTGCCCGGG + Intronic
1061595179 9:131624312-131624334 GCACACCATGGCTGTAGCTCAGG + Intronic
1062108281 9:134767412-134767434 CCCCACCCTGGGAGGACCCCTGG + Intronic
1062302742 9:135884573-135884595 GCCTTCCATAGCTGGAGCCCTGG - Intronic
1062343104 9:136102469-136102491 CCCCACCCTCACTGGACCCCAGG - Intergenic
1062355021 9:136157877-136157899 CTCCACAGTGGCTGGAGTCCTGG - Intergenic
1062390095 9:136330399-136330421 ACCCACCAGGGATGGTGCCCAGG - Intronic
1062423773 9:136496862-136496884 CCCCTCCGCTGCTGGAGCCCAGG + Exonic
1062424224 9:136498612-136498634 CCCCGCCATGACTGCCGCCCAGG + Intronic
1062491290 9:136806290-136806312 TCCCAGCCTGGCTGCAGCCCGGG - Intronic
1062501304 9:136853128-136853150 CCCAACCACTGCAGGAGCCCTGG + Exonic
1062533699 9:137012512-137012534 CCGCACCATGGGTGGGGCCCTGG + Exonic
1062682730 9:137790937-137790959 CCTCATCAAGGCTGGGGCCCTGG + Exonic
1186223800 X:7376162-7376184 CCCAGCCATGGCTGCAGACCTGG - Intergenic
1186239056 X:7546789-7546811 TCCCACAAGGGTTGGAGCCCGGG + Intergenic
1187319364 X:18226418-18226440 CCCCACCCCGGCTGCACCCCAGG + Intergenic
1188514200 X:30967567-30967589 GCCCACCATTGCATGAGCCCAGG - Intronic
1190322810 X:49188426-49188448 CCCCACCCTGTCTGGAACCCTGG + Exonic
1192150082 X:68706667-68706689 GCCCACCAAGGCTTGAGCCCTGG - Intronic
1195027694 X:100894530-100894552 CCCTGCCATCGCTTGAGCCCCGG - Intergenic
1199286379 X:146059161-146059183 CTCCTCCATGGCTGGAGCATGGG + Intergenic
1200231963 X:154448588-154448610 CTCCACCAGGGCTGGAGTCGAGG - Intronic
1201144861 Y:11058789-11058811 CTCCTCCATGGCAGGAGGCCTGG + Intergenic