ID: 1176076336

View in Genome Browser
Species Human (GRCh38)
Location 20:63250051-63250073
Sequence GGTCGCCGCCCTGGAGAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 155}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176076336_1176076343 -8 Left 1176076336 20:63250051-63250073 CCTGCCTCTCCAGGGCGGCGACC 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1176076343 20:63250066-63250088 CGGCGACCTAGGAGCAGGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 150
1176076336_1176076345 3 Left 1176076336 20:63250051-63250073 CCTGCCTCTCCAGGGCGGCGACC 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1176076345 20:63250077-63250099 GAGCAGGGCGGGCGCCATGAAGG 0: 1
1: 0
2: 1
3: 5
4: 183
1176076336_1176076352 26 Left 1176076336 20:63250051-63250073 CCTGCCTCTCCAGGGCGGCGACC 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1176076352 20:63250100-63250122 GTGGACCCGAGGGAGGCCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 197
1176076336_1176076349 16 Left 1176076336 20:63250051-63250073 CCTGCCTCTCCAGGGCGGCGACC 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1176076349 20:63250090-63250112 GCCATGAAGGGTGGACCCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 84
1176076336_1176076346 4 Left 1176076336 20:63250051-63250073 CCTGCCTCTCCAGGGCGGCGACC 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1176076346 20:63250078-63250100 AGCAGGGCGGGCGCCATGAAGGG 0: 1
1: 0
2: 1
3: 7
4: 111
1176076336_1176076347 7 Left 1176076336 20:63250051-63250073 CCTGCCTCTCCAGGGCGGCGACC 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1176076347 20:63250081-63250103 AGGGCGGGCGCCATGAAGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 201
1176076336_1176076342 -9 Left 1176076336 20:63250051-63250073 CCTGCCTCTCCAGGGCGGCGACC 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1176076342 20:63250065-63250087 GCGGCGACCTAGGAGCAGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 123
1176076336_1176076351 19 Left 1176076336 20:63250051-63250073 CCTGCCTCTCCAGGGCGGCGACC 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1176076351 20:63250093-63250115 ATGAAGGGTGGACCCGAGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 158
1176076336_1176076348 15 Left 1176076336 20:63250051-63250073 CCTGCCTCTCCAGGGCGGCGACC 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1176076348 20:63250089-63250111 CGCCATGAAGGGTGGACCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176076336 Original CRISPR GGTCGCCGCCCTGGAGAGGC AGG (reversed) Exonic
900216030 1:1482120-1482142 GGTGGCTGCCCCAGAGAGGCAGG - Exonic
900223149 1:1520123-1520145 GGTGGCTGCCCCAGAGAGGCAGG - Exonic
900760610 1:4467694-4467716 GCTCACAGCCCTGTAGAGGCTGG + Intergenic
901775858 1:11560133-11560155 GGTCCCCGCCCTGGTGAGGGGGG - Intergenic
904617173 1:31756148-31756170 TGCAGCTGCCCTGGAGAGGCGGG - Exonic
906062750 1:42958974-42958996 GAGCGCCGCCCAGGACAGGCTGG - Intergenic
907407616 1:54263314-54263336 TGAAGCCGTCCTGGAGAGGCGGG + Intronic
915266350 1:154720853-154720875 GGCCGAGGCCCTGGAGAGGCGGG + Intronic
916655992 1:166875968-166875990 ACTCACCGCCCTGGAGAGACCGG - Intronic
920033064 1:203048815-203048837 GGTGGCCAGCCTGGAGAGGTGGG + Intronic
920295664 1:204954651-204954673 AGGGGCCGCCCTTGAGAGGCAGG - Intronic
920442169 1:205988707-205988729 GGTCTCCGCCCCGCAGAGGAGGG + Intronic
922221207 1:223609942-223609964 AGTCGAGGCCCTGGGGAGGCTGG - Intronic
1063771910 10:9213748-9213770 GATCTCAGCCCTGGAGGGGCAGG - Intergenic
1065390372 10:25175926-25175948 GATGGCCGCCCGGGAGATGCTGG - Exonic
1067685413 10:48463846-48463868 GGTGGCGGCCCTGGAGAGCTCGG - Intronic
1070768712 10:79070329-79070351 GCTCCCCGCCCTGGAGCGGTGGG + Intronic
1071256186 10:83873863-83873885 GGTCACAGCACTGGAGAGGATGG - Intergenic
1071493560 10:86152797-86152819 GGCAGCCGCACTGGAGAGGATGG - Intronic
1073849065 10:107593237-107593259 GGTCCCCACCCAGTAGAGGCTGG - Intergenic
1076310952 10:129507207-129507229 GCACACCACCCTGGAGAGGCTGG - Intronic
1076889704 10:133277492-133277514 GGCCGCAGGCCTGGAGACGCCGG - Intergenic
1077108174 11:850807-850829 GGTCGCCTGCCTGGAGGGGCGGG - Intronic
1077580456 11:3413948-3413970 GGTCGCGGTCCTGCGGAGGCTGG - Intergenic
1079237201 11:18699195-18699217 GGTCGCGGCCCGGGAGAGGGAGG + Intronic
1083378836 11:62247729-62247751 GGTCACAGCCCTGGTGATGCTGG - Intergenic
1084178586 11:67435726-67435748 TGTCACCGCACTGTAGAGGCCGG - Exonic
1084412928 11:69014428-69014450 GCTGGCTGCCCTGGAGAGGAGGG - Intergenic
1084705878 11:70815722-70815744 GGTGGGGGCCCTGGGGAGGCTGG + Intronic
1085784985 11:79440752-79440774 GGACGCCGGCCGGGAGCGGCCGG - Intronic
1091335353 11:134762268-134762290 AGGCGCCGGCCTGGAGAGGCTGG + Intergenic
1092100982 12:5883604-5883626 GGTGGCCCCCATGGAGAAGCAGG + Intronic
1094108030 12:26833468-26833490 TGCGGCCGCCCTGGAGAGGCCGG + Intergenic
1098604948 12:72379126-72379148 GGTCTCCTCCCTGGAGAACCAGG + Intronic
1106180061 13:27362575-27362597 GGACGCCCCTCTGCAGAGGCGGG + Intergenic
1106276644 13:28215255-28215277 TGTAGACACCCTGGAGAGGCTGG - Intronic
1108437332 13:50413630-50413652 GGGGGCCGACCTGGAGAGTCGGG + Intronic
1117911558 14:60642364-60642386 GGTCCCCGCCCTGTGGCGGCAGG - Intergenic
1121104314 14:91270902-91270924 GGTCGCCGGCATGCAGAGGGAGG + Intergenic
1121283311 14:92714884-92714906 GGTGGAAGCCCTGGTGAGGCAGG - Intronic
1122151343 14:99727701-99727723 GGACACGGCCCTGGAGAGGAAGG - Intergenic
1122211880 14:100178736-100178758 GGTCCCAGCTCTGAAGAGGCTGG + Intergenic
1122397142 14:101441687-101441709 TCTAGCCGCACTGGAGAGGCAGG - Intergenic
1123587431 15:21772631-21772653 TGTCCCTGCCCTGGAGAGGATGG + Intergenic
1123624069 15:22215196-22215218 TGTCCCTGCCCTGGAGAGGATGG + Intergenic
1128388398 15:67166450-67166472 GGACGCCTCCCTGGAGGGGGTGG + Intronic
1128865940 15:71115369-71115391 GGTCGCCGCCAGGGGGCGGCAGG + Exonic
1129687732 15:77696163-77696185 CGCCCCCTCCCTGGAGAGGCCGG - Intronic
1131107936 15:89747365-89747387 GGTCGCTGCTCTGGAAATGCTGG + Intergenic
1131802570 15:96086324-96086346 GGTTGCCGCCCTGAAGGAGCTGG - Intergenic
1132618251 16:852781-852803 GGTCTCCCCCTTGCAGAGGCTGG + Intergenic
1132642967 16:986210-986232 GGAGGCCGCCCTGGAGGGCCCGG + Exonic
1132915313 16:2340686-2340708 CGTGGCCGCCCTGGAGGGGAGGG + Exonic
1136599012 16:31271697-31271719 GCTCTCCGTCCTGGTGAGGCAGG + Intronic
1137676065 16:50304407-50304429 GGACGCGGCCCTGAAGATGCGGG + Exonic
1137676896 16:50308314-50308336 TGCCGCCGTCCTGGAGAGGAGGG - Exonic
1138108900 16:54307641-54307663 GGTTGGAGCCCTGGAGAGACAGG + Intergenic
1140043722 16:71425995-71426017 GGCCGTCGCCCTGGAGACGGAGG + Intergenic
1144657119 17:17043675-17043697 GGCCCCCGCCCTGGAGTGACTGG + Intronic
1144853698 17:18256908-18256930 GCTGGCCGCCCTGCAGAAGCTGG - Exonic
1145059696 17:19724813-19724835 GCTCGCCGCCCCTGAGGGGCTGG - Intergenic
1146943064 17:36857151-36857173 GGCTGCGGCACTGGAGAGGCAGG - Intergenic
1148647023 17:49225070-49225092 GGAGCCCGCCCGGGAGAGGCTGG + Exonic
1151497949 17:74470563-74470585 ATTCGCAGCCCAGGAGAGGCAGG + Intronic
1152161980 17:78674656-78674678 GGGCGCAGCCCTGAGGAGGCAGG - Exonic
1152291668 17:79443277-79443299 GGTCTCCCCCGTGGCGAGGCCGG - Intronic
1152420027 17:80187719-80187741 TGTGGCAGCCCTGGGGAGGCAGG - Intronic
1153202016 18:2656201-2656223 GCTCCCCGACCTGCAGAGGCCGG - Exonic
1153794486 18:8609736-8609758 GGGCGCCGCGCTGCAGAGGCGGG + Exonic
1160184059 18:76660904-76660926 GGGCCCCGCCCTGGAGGGGCTGG + Intergenic
1160227649 18:77023744-77023766 GGTCCCCACCCTGGGGAGGCTGG + Intronic
1160452448 18:78974523-78974545 GCTCGCCGGCGTGGAGGGGCCGG - Intergenic
1160566855 18:79791306-79791328 AGCCTCTGCCCTGGAGAGGCTGG - Intergenic
1161211498 19:3068323-3068345 GGTGGCCGCCGTGCAGAAGCAGG + Intergenic
1161398965 19:4059251-4059273 GGTCCCCGCTCTGGAGTGGCTGG + Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1162079326 19:8209229-8209251 GGCTGGGGCCCTGGAGAGGCGGG - Intronic
1163821004 19:19496555-19496577 AGTCGAGGCCCAGGAGAGGCCGG + Intronic
1164639076 19:29811819-29811841 GGCCGGCGCCGTGGAGGGGCGGG + Intergenic
1166366182 19:42279769-42279791 GGAGACCGCCCTGGAAAGGCAGG + Intronic
1166672265 19:44718107-44718129 AGTCCCCACCCTGGAGAGACAGG - Intergenic
1166974900 19:46600361-46600383 GGTCGTCTGTCTGGAGAGGCTGG + Intronic
925730705 2:6917882-6917904 GGGCGCCGCCTGCGAGAGGCAGG - Intronic
927405409 2:22761004-22761026 GCTGGGTGCCCTGGAGAGGCAGG + Intergenic
928040778 2:27874789-27874811 GATTCCCTCCCTGGAGAGGCTGG + Intronic
929557386 2:42934158-42934180 GGCCTCCACCCTGGAGAGGTCGG + Intergenic
932595153 2:73088842-73088864 GGCCGCCGCCCTGGGGAGGGGGG - Intronic
934746650 2:96763821-96763843 GGTGGCCTCCCTGCAGAGACTGG + Intronic
934913730 2:98281047-98281069 GCTCCCCGCCCCGGAGATGCTGG + Intronic
937244726 2:120485269-120485291 GGACTCGGCCCAGGAGAGGCAGG + Intergenic
939273671 2:139971547-139971569 AGTTGCCACCCTGGAGAGGAGGG + Intergenic
941784156 2:169479705-169479727 GCTCGCGGCCCTGGTGAGGGTGG + Intronic
947765133 2:232633229-232633251 GCTCGCGGCCCGGGACAGGCTGG - Exonic
948230893 2:236348660-236348682 GGTCTCAGCCCTGGAGATTCTGG + Intronic
948855930 2:240730558-240730580 GATCGCCTCCCTGGAGAACCTGG - Intronic
1168892610 20:1304807-1304829 TGTCACCGCCAAGGAGAGGCAGG - Intronic
1170696368 20:18662966-18662988 GGTCCAGGGCCTGGAGAGGCTGG + Intronic
1171997044 20:31739488-31739510 GGTCGCCGCCTAGGCGGGGCAGG + Exonic
1172174841 20:32966056-32966078 GGGCTCAGCGCTGGAGAGGCAGG - Intergenic
1174036027 20:47668776-47668798 GGTCACCGGCGTGGAGAGGCAGG - Intronic
1174375549 20:50124496-50124518 GGTAGCCGGCCAGAAGAGGCTGG - Exonic
1175410968 20:58768874-58768896 GGTAGCCTCCCTGCAGTGGCAGG - Intergenic
1176076336 20:63250051-63250073 GGTCGCCGCCCTGGAGAGGCAGG - Exonic
1176161687 20:63651945-63651967 GGAGGCGGCCCTGGAGAGGACGG + Intronic
1180041332 21:45281876-45281898 GGTCGCCGGCCTGGTGAGCTGGG - Intronic
1181235559 22:21445970-21445992 GGTCCCTGCCCGGGAGAGGAGGG + Exonic
1182485190 22:30635163-30635185 GGGCGCCGCCCTGGACTGGGAGG + Intergenic
1184172760 22:42769366-42769388 GGTCTGCGCTGTGGAGAGGCAGG + Intergenic
1184569010 22:45310336-45310358 GTTCGCGGGCCTGGAGGGGCAGG - Intronic
1185006379 22:48279155-48279177 GGTTGCAGCCCTGCAGAGGAGGG + Intergenic
952969529 3:38641954-38641976 GGTCCCCACCCTGGAGACCCAGG - Intronic
953032951 3:39189903-39189925 AGTCCCAGCCTTGGAGAGGCAGG + Intronic
954735807 3:52705829-52705851 GGCCGTCGCCATGGAGACGCGGG + Exonic
961556061 3:127697294-127697316 TGTCGCAGCCCTGCACAGGCTGG - Intronic
961574297 3:127822524-127822546 GCTCCCCGCCCTGGGGAGGGAGG - Exonic
961603227 3:128076385-128076407 GGCGGCCGGCATGGAGAGGCGGG + Intronic
961654054 3:128432071-128432093 GGTAGCGGCCATGCAGAGGCCGG + Intergenic
962750941 3:138434537-138434559 AGTCTCCGCCCTAGAGGGGCGGG - Intergenic
965590353 3:170356797-170356819 GGAGGCCGCCCGGGCGAGGCCGG + Intergenic
966743529 3:183254483-183254505 GGCCGCCGCCCAGGTGCGGCAGG + Intronic
967123815 3:186407157-186407179 GGTCGCCTCCCTGAAGAGAAGGG + Intergenic
968086631 3:195876815-195876837 GGTCACCGCCCGGGCAAGGCGGG - Intronic
968688838 4:1979332-1979354 CGTCGCCACTCGGGAGAGGCTGG + Exonic
968890216 4:3364831-3364853 GGTCGCTGCCTGGGAGAGCCAGG + Intronic
969214508 4:5711311-5711333 CGTCGCCGCCCTGGCGGGGACGG + Exonic
969387934 4:6868622-6868644 GGTCGCTGTCATGGACAGGCAGG - Intronic
970194378 4:13541086-13541108 GGTGGGCGCCGTGGAAAGGCTGG + Exonic
985497725 5:218809-218831 GGTGGCCGCCCTGGCTGGGCTGG + Intronic
985549013 5:523986-524008 GGCGGCCGCCCGGGAGAGTCCGG - Intronic
988941596 5:36152873-36152895 GGTCTCCGCCCTGGAGAAAGAGG + Exonic
997199877 5:132003487-132003509 GGCCGCCTCCCAGGAGCGGCAGG + Intronic
997912437 5:137889367-137889389 GCTCGCCGCCCTGGAGGAGCTGG + Intronic
997980365 5:138464730-138464752 AGGGGCCGCCCAGGAGAGGCGGG - Intergenic
1004320658 6:14628966-14628988 TGTAGCAGCCCTGGAGAGGCTGG - Intergenic
1006716188 6:36122241-36122263 GGCCTCTGCCCTGGACAGGCAGG + Intergenic
1007584231 6:42978970-42978992 GGTGGCAGCCCTGGAGGGGCCGG - Exonic
1013117538 6:107114676-107114698 GGGCGCCGCGATGGAGCGGCCGG - Intronic
1017763093 6:157586053-157586075 GGTCACTGCCCTGGAGCAGCAGG + Intronic
1018993867 6:168695754-168695776 GGTCGACGCCCTGGATTTGCAGG + Intergenic
1019573217 7:1723633-1723655 GGGCACAGCCCTGGAGAAGCTGG - Intronic
1020092266 7:5348387-5348409 GCTCCCCGCCCTGGAGAGAAAGG - Intronic
1021845079 7:24756566-24756588 GGTCGCTGTCCTCGAGACGCAGG - Intronic
1026867961 7:73834919-73834941 GGAGGCCACCCTGGACAGGCTGG - Exonic
1027140123 7:75650826-75650848 TGTCCCCGCCCTGGGGAGGGTGG + Intronic
1027361638 7:77416098-77416120 CGTCGCCGCCCTGAGAAGGCTGG - Intronic
1027390370 7:77697152-77697174 GTGCGCCGGCCTGGAGGGGCTGG + Intronic
1032880023 7:136078921-136078943 TGTCGCCTCCCTGCAGAGACAGG - Intergenic
1035051342 7:156000674-156000696 GGGCAGCGCCCTGCAGAGGCCGG - Intergenic
1035583166 8:752849-752871 GGTCGCCTTCTTGGAGGGGCAGG - Intergenic
1035609254 8:949106-949128 GGTCGTGGCTCTGGAGAGGTTGG + Intergenic
1035644712 8:1210228-1210250 GGTGACCTTCCTGGAGAGGCTGG + Intergenic
1036848457 8:12185469-12185491 GGTCGGGGTCCTGCAGAGGCTGG - Exonic
1036869817 8:12427750-12427772 GGTCGGGGTCCTGCAGAGGCTGG - Exonic
1038731542 8:30132403-30132425 GGTCAGAGCCCTGGAGAGGAGGG - Exonic
1040080288 8:43277059-43277081 GGTTCCCGCCCTGAAGAAGCTGG - Intergenic
1041464677 8:58146371-58146393 GCTCAGCGCCGTGGAGAGGCTGG + Exonic
1048964286 8:139604131-139604153 AGTCTGCGCCCTGGAGAGCCAGG - Intronic
1049337922 8:142096329-142096351 TGCTGCGGCCCTGGAGAGGCAGG - Intergenic
1049411456 8:142475660-142475682 AGCCGGAGCCCTGGAGAGGCGGG + Intronic
1049529358 8:143146755-143146777 GGTGCCTGCCCAGGAGAGGCAGG + Intergenic
1052916577 9:33927930-33927952 GGTCGCTGCCGTGGAGAAGGTGG + Exonic
1061133872 9:128722565-128722587 TGCCGCAGCTCTGGAGAGGCCGG + Exonic
1061432079 9:130537357-130537379 GCTGGCCCCACTGGAGAGGCAGG + Intergenic
1062467864 9:136689063-136689085 GGTGGCCACCCTGGAAAGGTCGG - Intergenic
1062587170 9:137254667-137254689 GGGCGGCGGGCTGGAGAGGCGGG + Intergenic
1185618732 X:1439316-1439338 GGTGGTCGCCCTGCAGGGGCTGG + Intronic
1194660031 X:96620803-96620825 GGTCTCTGCCCTGGAGAAGGAGG + Intergenic
1200256404 X:154585297-154585319 GCTGGCGGCCCAGGAGAGGCGGG + Exonic
1200261365 X:154619106-154619128 GCTGGCGGCCCAGGAGAGGCGGG - Exonic
1200267348 X:154653403-154653425 GCTGGCGGCCCAGGAGAGGCGGG - Exonic
1200829070 Y:7673210-7673232 GGACACCGCACTGGAGCGGCAGG + Intergenic