ID: 1176078604

View in Genome Browser
Species Human (GRCh38)
Location 20:63260530-63260552
Sequence CTCCAAAAGCAGAGAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 306}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176078604_1176078615 27 Left 1176078604 20:63260530-63260552 CCTTGGCCTCTCTGCTTTTGGAG 0: 1
1: 0
2: 0
3: 36
4: 306
Right 1176078615 20:63260580-63260602 CCACAGCCACTCTACTGCACTGG 0: 1
1: 0
2: 2
3: 9
4: 229
1176078604_1176078611 -5 Left 1176078604 20:63260530-63260552 CCTTGGCCTCTCTGCTTTTGGAG 0: 1
1: 0
2: 0
3: 36
4: 306
Right 1176078611 20:63260548-63260570 TGGAGCAGGGCGCTGGGGCTAGG 0: 1
1: 0
2: 4
3: 76
4: 685
1176078604_1176078613 -3 Left 1176078604 20:63260530-63260552 CCTTGGCCTCTCTGCTTTTGGAG 0: 1
1: 0
2: 0
3: 36
4: 306
Right 1176078613 20:63260550-63260572 GAGCAGGGCGCTGGGGCTAGGGG 0: 1
1: 0
2: 3
3: 40
4: 425
1176078604_1176078612 -4 Left 1176078604 20:63260530-63260552 CCTTGGCCTCTCTGCTTTTGGAG 0: 1
1: 0
2: 0
3: 36
4: 306
Right 1176078612 20:63260549-63260571 GGAGCAGGGCGCTGGGGCTAGGG 0: 1
1: 0
2: 3
3: 52
4: 549
1176078604_1176078610 -10 Left 1176078604 20:63260530-63260552 CCTTGGCCTCTCTGCTTTTGGAG 0: 1
1: 0
2: 0
3: 36
4: 306
Right 1176078610 20:63260543-63260565 GCTTTTGGAGCAGGGCGCTGGGG 0: 1
1: 0
2: 4
3: 26
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176078604 Original CRISPR CTCCAAAAGCAGAGAGGCCA AGG (reversed) Intronic
901002424 1:6155305-6155327 CTACCAGAGCTGAGAGGCCATGG + Intronic
901137566 1:7007785-7007807 CTCCTCCAGAAGAGAGGCCAGGG + Intronic
902121265 1:14167932-14167954 CCAGAAAAGCTGAGAGGCCATGG - Intergenic
902384472 1:16068526-16068548 CTCAACAGGCAGAGCGGCCAAGG - Intronic
903372803 1:22847680-22847702 TTCCAAGAGCAGGGAAGCCAGGG - Intronic
904642976 1:31944552-31944574 CTGCACAGGCAGAGAGGCCAGGG - Intronic
905663478 1:39746678-39746700 CTCCAAAAGCTCAGAGGAAAGGG - Intronic
905827669 1:41038383-41038405 CTCCACAAGCAGAGAAGCTGTGG - Intronic
905919294 1:41708850-41708872 CTCCAACAGCAGAGAAGACATGG - Intronic
906902350 1:49848840-49848862 ATCCAACAGCAGAAAGTCCATGG + Intronic
908298317 1:62735700-62735722 CCACAAAAGCAGGGATGCCAAGG - Intergenic
909610160 1:77542977-77542999 CTACAAAAGCAGAGTTGCCAAGG - Intronic
910043336 1:82881459-82881481 CTCCAAAAGCATAAAGGCTTTGG + Intergenic
910181575 1:84490002-84490024 CACCTAAAGCATAGAGGCCAGGG - Intronic
911438928 1:97900145-97900167 CTCCAAAAGCAGAGAAGAACAGG - Intronic
911841487 1:102687533-102687555 CTCCAAAAACAGAAAGGAAAAGG - Intergenic
913459561 1:119069901-119069923 CTCCAGAAGCAGAGACGTGAGGG + Intronic
914353423 1:146860257-146860279 CTCCTCAGGCAGAGAAGCCAGGG + Intergenic
914409318 1:147410242-147410264 CCCCAAAAGCTCAGAGGCTAGGG - Intergenic
915209910 1:154300789-154300811 CTCCATAAGCAGAGCAGCCCCGG - Intergenic
915728411 1:158035392-158035414 CTCCATCAGCAGAGGGTCCAGGG + Intronic
915839092 1:159201146-159201168 ACCCAAATGCAGAGAAGCCACGG - Exonic
915905674 1:159875255-159875277 GTCCAAGGGCATAGAGGCCAGGG + Intronic
916930645 1:169575178-169575200 GTCCAAAGGCAGAGAGGAAAAGG + Intronic
917510062 1:175662416-175662438 CACCAAGAGGAGACAGGCCAGGG - Intronic
919571024 1:199247663-199247685 CCCCAAATGGAGAGAGGTCATGG + Intergenic
919772548 1:201171695-201171717 CTCAAAAGGCAGAGAGGCGCAGG - Intergenic
919798510 1:201336559-201336581 TTCCAAAAGTTGAGAGGTCAAGG + Intergenic
920679546 1:208062143-208062165 GTCCAAAAACAGAGAGGCTGTGG - Intronic
920850409 1:209624469-209624491 CTCCAAGAGCTCAGTGGCCAAGG - Intronic
920930298 1:210381783-210381805 CTCCAAAAACAGTGGGACCAGGG + Intronic
921556782 1:216608329-216608351 CCCCAAAAGCAATGAGACCAGGG - Intronic
923019684 1:230153735-230153757 CTCCAAGAGCGGAGTGGCCTCGG - Intronic
923965531 1:239134586-239134608 CTGCACATGCAGACAGGCCAAGG + Intergenic
924147147 1:241088192-241088214 CTTCAAGACCAGAGTGGCCATGG + Intronic
924454259 1:244205893-244205915 CTCCATAGGCAGAGCAGCCAAGG + Intergenic
1063669978 10:8092259-8092281 CTCCCAAAGCATTCAGGCCAGGG + Intergenic
1064362912 10:14681746-14681768 GTCCAAAAGCAGAGGAGCAAGGG + Intronic
1064651523 10:17514649-17514671 CTCCACACCCAGATAGGCCAGGG - Intergenic
1064698019 10:17987797-17987819 CTACAAGTGCAGAGAGGCCTTGG - Intronic
1064729929 10:18319902-18319924 ACCCAAGAACAGAGAGGCCAGGG + Intronic
1065637590 10:27746180-27746202 CTCCAGAAGCTGAGAGGCTGCGG + Intergenic
1066456220 10:35574632-35574654 CTCCTAAAGAAGGGTGGCCATGG + Intergenic
1066503265 10:36015387-36015409 CACCAAACGCACAGAGTCCAGGG - Intergenic
1068226826 10:54117159-54117181 AGCCAAAAGCAGAGTGGCAAAGG + Intronic
1069212679 10:65780604-65780626 CTACAAAATCAGAACGGCCAGGG - Intergenic
1069288575 10:66747703-66747725 CTCCAAAAGCAGAGTCACCTGGG + Intronic
1069834448 10:71299763-71299785 GTCCAAAAGCAAAAAGGCAAAGG + Exonic
1071396594 10:85229686-85229708 ATCCACATGCAGAGAGGCCATGG + Intergenic
1071529839 10:86380736-86380758 CTGCAAAGGCAGAGAGGGCAGGG - Intergenic
1072116423 10:92374472-92374494 CTCCAAAAGGAGGGAGGGGAGGG - Intergenic
1074931859 10:118135292-118135314 CTCCAATAAAAGAGAGACCAAGG + Intergenic
1075115915 10:119627164-119627186 CTCGCTAAACAGAGAGGCCAGGG - Intergenic
1076087098 10:127642847-127642869 CTGCAAAGACAGAGAGGCCCAGG - Intergenic
1076139865 10:128070284-128070306 CTGCATCTGCAGAGAGGCCAGGG - Exonic
1076513037 10:131025685-131025707 CCCTCAAAGCAGAGAGGGCACGG + Intergenic
1077307744 11:1875578-1875600 CTCCCCAGGCAGAGAGGCTAGGG + Intronic
1077440275 11:2565631-2565653 CCCCAAAACAAGATAGGCCACGG - Intronic
1078797418 11:14606664-14606686 ATTAAAAAGCAGAGAGGCTAAGG + Intronic
1083047385 11:59749076-59749098 CCCCAACAGCAGAGACCCCAGGG - Intronic
1083696098 11:64443732-64443754 CTCCACCTGCAGAGATGCCAAGG - Intergenic
1083725370 11:64625250-64625272 TTCCAGAATCAGAGAGGCCAAGG - Intronic
1084439809 11:69166370-69166392 CTCCACATGCAGACCGGCCATGG - Intergenic
1085086047 11:73667893-73667915 CCAAAAAAGCAGAGAGGACAGGG + Intergenic
1085736735 11:79045570-79045592 CTCCAGTAGCAGCCAGGCCAGGG - Intronic
1087751353 11:102010937-102010959 CTGCAAAACCAGAAAGGCCCAGG + Intergenic
1087990298 11:104740732-104740754 CTCCAAAACCAGAGAAGACTCGG - Intergenic
1088910036 11:114183782-114183804 CTCCAAGAGCAGAGTGGGCCTGG - Intronic
1089321445 11:117629365-117629387 CTCCCCAAGCTGGGAGGCCACGG + Intronic
1091205371 11:133817487-133817509 CTTCAACAACAGAGAGCCCAGGG + Intergenic
1091409947 12:232800-232822 TTCCAGAAGCAGACAGACCATGG - Intronic
1095538324 12:43278298-43278320 CTCCAAAAGTAAAGAGGACATGG + Intergenic
1096748728 12:53745349-53745371 CTCAAAAACCAGAGTGGACAAGG + Intergenic
1099901719 12:88718762-88718784 CTTCAAAAAAATAGAGGCCAAGG - Intergenic
1101984309 12:109433695-109433717 CTACAGATGGAGAGAGGCCAAGG - Intronic
1104285358 12:127419675-127419697 CTCCAAGAAAAGGGAGGCCAGGG + Intergenic
1105726907 13:23171954-23171976 ATTCAAAATCAGGGAGGCCAGGG + Intergenic
1107293217 13:38880724-38880746 CTCCAGCAGCAGTGAGCCCATGG + Exonic
1107514707 13:41117878-41117900 CTGAGAAAGCTGAGAGGCCAAGG + Intergenic
1108411289 13:50150028-50150050 CTCCAGAAAAAGAGATGCCATGG - Intronic
1108457787 13:50634027-50634049 CTCCAAATGCAGAGAAGGAATGG - Intronic
1108732360 13:53248113-53248135 GTGCAAAGGCAGAGAGGCCAGGG - Intergenic
1109008401 13:56908561-56908583 CTCCAAAAGCAGGGAGGAAAGGG + Intergenic
1109532510 13:63668851-63668873 CTCCAAAGGCAGAGAATGCAGGG + Intergenic
1110305690 13:73984461-73984483 CTCTAACTTCAGAGAGGCCAGGG - Intronic
1110818276 13:79884916-79884938 CTCCAACAGCACAGAGCCCATGG - Intergenic
1111444875 13:88334518-88334540 TTCCAAAAGCTCAGAGGTCATGG - Intergenic
1112181478 13:97086000-97086022 CTGCAAAAACACAGAGGCCGGGG - Intergenic
1112331967 13:98483561-98483583 CTCCAAAAGCAAAAAGGCCTGGG - Intronic
1113073575 13:106446442-106446464 CCACAAGAGCAGAGAGGGCAGGG + Intergenic
1113094200 13:106646466-106646488 CAGCAGATGCAGAGAGGCCAAGG + Intergenic
1113333702 13:109357454-109357476 ATCCAAAAGCAGAAGGCCCAGGG - Intergenic
1113405057 13:110031352-110031374 CTCCAAATGCAGCCACGCCAGGG + Intergenic
1113491970 13:110699329-110699351 CACAAAAAGCAGAGAGAACAGGG + Intronic
1115374671 14:32661155-32661177 GTCAAAATGCAGAGAAGCCAAGG + Intronic
1115876591 14:37868423-37868445 CTTCAAAAGGAGAGAGAACATGG - Intronic
1118462105 14:65996768-65996790 CTCCAAAAGTAGAGTGGCCTGGG - Intronic
1118589787 14:67392764-67392786 CTCCATGAGCATGGAGGCCAGGG + Exonic
1119435571 14:74595653-74595675 CTGACAAATCAGAGAGGCCAGGG + Intronic
1119480888 14:74956889-74956911 AGCCAAGAGCAGGGAGGCCAGGG + Intergenic
1119670302 14:76513415-76513437 CTGCAAAAGCAGATTGGACAGGG + Intergenic
1122379622 14:101293163-101293185 CTCCAAGAGAAGAGGGGACAGGG + Intergenic
1124043113 15:26123354-26123376 CTCCAAAATCAGAGAACCAATGG - Intergenic
1124052513 15:26210879-26210901 CTCCAGCAGCAGACAGGCAAAGG + Intergenic
1125404867 15:39341735-39341757 ATCCAAAACCAGAGAGGGGAGGG - Intergenic
1125506241 15:40269348-40269370 ATCCTAAAGGGGAGAGGCCATGG - Intronic
1128263970 15:66252386-66252408 CTCCAAGAGCCGAGAGAACAGGG - Intronic
1129656436 15:77528094-77528116 CTCCCCCAGCAGACAGGCCAAGG - Intergenic
1130014724 15:80177713-80177735 CTCCTAAAAGAGACAGGCCATGG - Intronic
1131592404 15:93763871-93763893 CTACAAGACCAGAGAGGGCATGG - Intergenic
1131622590 15:94083141-94083163 AGCCAAGAGCAGAAAGGCCACGG - Intergenic
1132724028 16:1331149-1331171 GTCCGAAGGCAGAGACGCCAGGG + Intergenic
1134417445 16:14056599-14056621 CTCCAAAAAAAGAGAGACCAGGG - Intergenic
1134512362 16:14858837-14858859 CTCTGAAAGCAGAGACGACAAGG + Intronic
1135352985 16:21745680-21745702 ATCCAAGTTCAGAGAGGCCACGG - Intronic
1135451471 16:22561803-22561825 ATCCAAGTTCAGAGAGGCCACGG - Intergenic
1135840773 16:25874080-25874102 CTGGTAAAGCAGAGAGGACAGGG - Intronic
1136395981 16:29992768-29992790 GGCTAAAAGCAGAGGGGCCACGG + Exonic
1136428954 16:30186146-30186168 TCCCAAAAGGAGAGGGGCCAGGG - Intronic
1137223021 16:46474138-46474160 CACACAAAGCAGAGATGCCAGGG + Intergenic
1138041673 16:53677747-53677769 CTCCACAAGCACAGAGGTCTAGG - Intronic
1139056016 16:63185391-63185413 CTCTAAAAGCAAAGAGTCCCAGG + Intergenic
1139398942 16:66664732-66664754 CTCCAAAAGAAAAGAGGAAAGGG + Intronic
1139980599 16:70855261-70855283 CTCCTCAGGCAGAGAAGCCAGGG - Exonic
1140599459 16:76457944-76457966 CTTCAAAAGGGGAGAGGGCATGG - Intronic
1141136411 16:81468516-81468538 CTCTGAAAGCACAGAGGGCACGG - Intronic
1141189474 16:81814082-81814104 CTCCATAAGGAGAGAGGATAAGG + Intronic
1141206768 16:81938928-81938950 GTTTAAAAGCAGAGGGGCCAAGG - Intronic
1141748467 16:85942224-85942246 TTCCCAAGGGAGAGAGGCCAGGG - Intergenic
1142285616 16:89170373-89170395 CTCCAAGATGAGAGAGGGCAGGG - Intergenic
1144023086 17:11254265-11254287 ATCCCACAGCAGAGGGGCCAAGG - Intronic
1144671426 17:17134696-17134718 CTCCAGAAGCAGGAAGGCCATGG - Intronic
1145127321 17:20312957-20312979 AGCCAGAAGCAGAGATGCCATGG - Intronic
1146206383 17:30908550-30908572 CTACAAACCCAGAAAGGCCAAGG + Intronic
1146706503 17:35004250-35004272 CTGCAAATGCAGAGGGGTCAGGG - Intronic
1146945321 17:36869583-36869605 CTGGAAAAGGAGAGGGGCCAGGG + Intergenic
1147166080 17:38594137-38594159 CACAAACAGCAGAGGGGCCAAGG - Intronic
1147314598 17:39613621-39613643 CTCCTAAAGCAGAAAGGCTGAGG + Intergenic
1147920882 17:43916302-43916324 CTCCCAAAGGAGATAGGCCTGGG - Intergenic
1148444386 17:47728641-47728663 CTGCAGAGGCAGAGAGGCCTGGG - Intergenic
1148579611 17:48734570-48734592 CTCCAACAACAGGGCGGCCACGG + Intergenic
1148959308 17:51379911-51379933 CTCCAGAAGCATGGAGCCCAGGG + Intergenic
1149305574 17:55343553-55343575 CAGCACAAGGAGAGAGGCCATGG + Intergenic
1149645445 17:58237940-58237962 CTCCAGAATCTGGGAGGCCAAGG - Intronic
1150418487 17:65007061-65007083 CTCAAAAAGCAGATGGCCCAGGG - Intergenic
1151550960 17:74822257-74822279 CTCCAACAGCAGAATGGCAAGGG - Intronic
1152320370 17:79605581-79605603 CTCCAGAAGAACAGAGGCCTAGG - Intergenic
1154356381 18:13625522-13625544 CGCAAGAAGCAGAGAAGCCAGGG - Intronic
1154370624 18:13758920-13758942 CTCCAGGAACAGAGAGGCCAAGG + Intronic
1157386104 18:47261018-47261040 CTCCAAAGGAAGGGAGGCCGAGG + Intergenic
1157815184 18:50724979-50725001 CTCCAAGAGCAGAGCTCCCAGGG + Intronic
1157958005 18:52120630-52120652 ATCCAAAAGTGTAGAGGCCAAGG + Intergenic
1158666570 18:59438145-59438167 CCCTAAAAACAGAAAGGCCAGGG + Exonic
1160820883 19:1057220-1057242 CTCAAAAAGCAAGGAGGTCAGGG + Intronic
1161822631 19:6539710-6539732 CTCCAAAAGAAGTGAGGGTAGGG + Intergenic
1161847627 19:6720720-6720742 CCCCAAAAGGGGAGAGGCCATGG - Intronic
1163095990 19:15057493-15057515 ATGGAAAAGCAGAGAGGCAAGGG - Exonic
1163458873 19:17424617-17424639 CCCCAAAAGCAGAGAAGGCCTGG - Exonic
1164532018 19:29055978-29056000 CTCAGAAAGCTGGGAGGCCAGGG - Intergenic
1164633343 19:29775762-29775784 CTTCAGGAGCAGAGAGGCCCGGG - Intergenic
1164805310 19:31111835-31111857 CTCCCCAAGCAGAGAGGGCAAGG - Intergenic
1167239551 19:48335324-48335346 ATCCCAACGCTGAGAGGCCAAGG + Intronic
1167496369 19:49821280-49821302 CTCAAAAACAAGAGAGGCCTGGG - Intronic
1168266474 19:55226437-55226459 CTCCAGAAGCCGAGAGGGCAAGG + Intergenic
1168604425 19:57747140-57747162 GTCCAAAAGCAGAGAGGAAGCGG + Intronic
925242094 2:2340230-2340252 CTCAGAAAGCAAACAGGCCAGGG - Intergenic
925634889 2:5933516-5933538 GTCCCAAAGCACAGAGTCCATGG - Intergenic
927170963 2:20369084-20369106 CACCAAAACTATAGAGGCCAAGG - Intergenic
927622198 2:24673441-24673463 CTCCAAAAGAAGAGGTCCCAAGG - Exonic
929533292 2:42765254-42765276 CTCCATATGCAGACAGGCCTGGG + Intergenic
929992879 2:46804281-46804303 CTCCAAGAGCAGTCAGGCCGGGG + Intergenic
930579497 2:53193445-53193467 CACCAACAGCAGGAAGGCCATGG - Intergenic
931121257 2:59222842-59222864 CTGCAAAAGCAAAGAGGGGAAGG + Intergenic
931197308 2:60064634-60064656 CTCCAAAAGCAAAGGGGGCCAGG + Intergenic
931705272 2:64941904-64941926 CCCAACAAGCAGAGAGGGCAAGG - Intergenic
933215813 2:79628901-79628923 CTCCAAAGGCAGAGTTGCTAAGG - Intronic
933313922 2:80693338-80693360 ATCCAGAAGCAAAGAGGCAAAGG + Intergenic
933765591 2:85706502-85706524 CTCCAAAAGAAGATAGGCAGAGG + Intergenic
933850268 2:86361122-86361144 TTCCAACAGCAGGGAGCCCAAGG + Intergenic
934958889 2:98649710-98649732 ACCCACAAGCAGAGAGGACATGG + Intronic
935369847 2:102333734-102333756 CTCCAAAAGTAGGGAGGGTAGGG - Intronic
936118871 2:109724836-109724858 CTCCAAAAGTAGGGAGGGCACGG + Intergenic
936398368 2:112147581-112147603 AGCCAAATGCAGAGAGGCCGGGG - Intronic
937053014 2:118907675-118907697 CTAGAAAAGCAAAGGGGCCAGGG + Intergenic
938090255 2:128426534-128426556 CCCCAAAAGGAGAGTGGTCAGGG - Intergenic
938247841 2:129792667-129792689 CTCCAAAAAAAACGAGGCCATGG - Intergenic
944636055 2:201677199-201677221 CTCCCAGAGGAGAAAGGCCAGGG - Intronic
948267025 2:236642560-236642582 CTCCAAGAACACAGAGGCCCCGG - Intergenic
1171293699 20:23998078-23998100 CTCCAAAAGTGGAGAGGGAAGGG - Intergenic
1174164405 20:48574631-48574653 CTCCAAAAGCAGCTGGACCAAGG + Intergenic
1174600351 20:51719255-51719277 CAACAAGAGCAGAGAGGACAAGG + Intronic
1175084305 20:56445803-56445825 CTCCAAAAGCAGAGACAGCTGGG - Intronic
1175394489 20:58649585-58649607 ATCCAAAGACAGAGAGGCCCTGG - Intergenic
1175490676 20:59379278-59379300 CTGCAAAACCAGAGAGGTCAGGG - Intergenic
1176078604 20:63260530-63260552 CTCCAAAAGCAGAGAGGCCAAGG - Intronic
1177011725 21:15738763-15738785 ATCCACAAGCAGACAGCCCAGGG + Intronic
1177829918 21:26126534-26126556 CTCAAAAAGCAAAGTGGCCTAGG - Intronic
1178127770 21:29534027-29534049 CCCCAACATCAGAGAGGCCATGG - Intronic
1185080692 22:48707952-48707974 ATCCTCATGCAGAGAGGCCAGGG + Intronic
949748934 3:7328639-7328661 TTCCAAAAGCAGAAAGTCTAGGG - Intronic
950670849 3:14524536-14524558 CTCCTAGAGCAGGAAGGCCAGGG + Exonic
950878888 3:16305233-16305255 CTCCTAATGCAGAGAGGTCTGGG - Exonic
950977636 3:17265744-17265766 ATCCAAGTGCAGAGATGCCATGG + Intronic
951041746 3:17995549-17995571 GTCCAAAAGTAGGGAGGCCAGGG - Intronic
951076763 3:18402836-18402858 CTCCATCAGCAGAGAGGGCAAGG + Intronic
951792957 3:26506885-26506907 CTCCACAAGCAGAGAGAGCAGGG - Intergenic
952272760 3:31848714-31848736 GGCCAAAAGCTGAGAGTCCAAGG + Intronic
952560151 3:34582819-34582841 CCTCGAAGGCAGAGAGGCCATGG + Intergenic
952834828 3:37593888-37593910 ATCCTAAAGCAAAGAGGCCAAGG - Intronic
952865823 3:37854563-37854585 CTCCCAGAGCAGAGGGGGCAGGG - Intergenic
952996304 3:38885875-38885897 CATCAAATGCATAGAGGCCAAGG + Intronic
953535999 3:43777228-43777250 CTCCAAAAGCAGTAATGACAGGG - Intergenic
955117227 3:56017694-56017716 CTACAAAAGAAGAGAAGGCAGGG - Intronic
955935631 3:64099908-64099930 CACCATCAGCAGAGAGGCCTGGG + Exonic
956783111 3:72620051-72620073 CTCTAGAAGCTGACAGGCCAGGG - Intergenic
958016920 3:87948729-87948751 GTCCCAAAGCTGGGAGGCCAAGG - Intergenic
958758378 3:98276537-98276559 CCCCATAAAGAGAGAGGCCAGGG + Intergenic
961000267 3:123369450-123369472 CTCCAAATGCTTAGTGGCCATGG - Intronic
961140211 3:124549774-124549796 CTCCAAAAGCAGGAAAGACAGGG + Intronic
961445350 3:126978071-126978093 CACCATAAGCAGGGAGGACAAGG + Intergenic
961456288 3:127026183-127026205 TTCCAAGAGCTCAGAGGCCAGGG - Intronic
962312877 3:134338380-134338402 AGCCAAAAGCAGGGAGGACAGGG - Intergenic
963084377 3:141423049-141423071 CCCCAAAAGAAGGGAAGCCAGGG - Intronic
963344084 3:144072676-144072698 CTCTCAAAGCAGAGTGGTCACGG - Intergenic
964436497 3:156658957-156658979 ATCCACAAGCAGTGAGGCAAGGG - Intergenic
964614392 3:158646801-158646823 CTCCAACAGCACAGAGAACAAGG - Exonic
964742252 3:159978572-159978594 CCACCAAAGCAGAGGGGCCATGG + Intergenic
966244325 3:177789799-177789821 CTATAAAAGCAGAGAGGAGAGGG + Intergenic
966261622 3:177985199-177985221 CTCTAAACGCAGAGAAGCTATGG + Intergenic
967427226 3:189340910-189340932 ATCCAGAGACAGAGAGGCCATGG - Intergenic
968911197 4:3477755-3477777 CTCCAATCCCAGAGGGGCCAAGG - Intronic
969427595 4:7134787-7134809 CCCCACAGGGAGAGAGGCCAGGG - Intergenic
972534544 4:39988805-39988827 CTCCAAAAGGAGAGAGGGAGAGG - Intergenic
973628257 4:52793951-52793973 CACAATAAGCAAAGAGGCCAGGG - Intergenic
975107304 4:70581943-70581965 AACAAAAAGCAGAGAGCCCAAGG - Intergenic
975718033 4:77224527-77224549 CTAGTAAAGCACAGAGGCCAGGG + Intronic
977138241 4:93333754-93333776 GTGCAAAAACAGAGAAGCCAGGG - Intronic
978431267 4:108635307-108635329 CCCCAAAAGCAAAGAGTTCAGGG + Intergenic
979484844 4:121258503-121258525 TTCCACAAGCAGAGAGGTCTTGG + Intergenic
980532763 4:134075301-134075323 GTCAAAGAGCTGAGAGGCCAAGG + Intergenic
981880474 4:149605210-149605232 CTCCAAAAGCAAAAAGTCAATGG + Intergenic
981961922 4:150551582-150551604 CACTAAAACCAGAGAGGTCAAGG + Intronic
982297569 4:153845334-153845356 CTCCTAAGGCAGGGAGGTCAAGG + Intergenic
985631380 5:1015841-1015863 GTCCAACAGGAGAGGGGCCACGG - Intronic
985702329 5:1381068-1381090 CTCCAGCAGCAGAGCAGCCAGGG + Intergenic
985997445 5:3604878-3604900 ATTCAAAAGCAGAGAGGACAGGG - Intergenic
986104617 5:4648100-4648122 CACCTAAAGCAGAGAATCCATGG + Intergenic
986649880 5:9952872-9952894 CTCCAGAAGCTGAGAAGGCAAGG - Intergenic
991042285 5:62188356-62188378 ATCTGAAAGCAGAGAGACCAAGG + Intergenic
992668629 5:79036353-79036375 CTCAAAAAGCATATAGGCCTAGG - Intronic
993195680 5:84742264-84742286 CTCAAAAGTCAGAGAGGCAATGG + Intergenic
993493822 5:88585780-88585802 CTACCAAAACAGAGATGCCAAGG + Intergenic
993853101 5:93035692-93035714 CTGGAAAAGGAGAGAAGCCAGGG - Intergenic
994019297 5:95004789-95004811 CTGCAAAAGCAGAGTCCCCATGG + Intronic
996683048 5:126249191-126249213 CTACTGAAGCAGATAGGCCAGGG + Intergenic
997023131 5:130025697-130025719 CTCCCATAGCAGAAGGGCCAGGG + Intronic
997286465 5:132682248-132682270 CCCCAAAAGCAGATAGGTAATGG + Intronic
998424078 5:142012548-142012570 CTCCAGAAGTAGAGAGGTCATGG + Exonic
999128277 5:149263110-149263132 CTCCAAATGAATAGAGTCCAGGG + Intergenic
999280455 5:150361921-150361943 ATCCAAGAGCAGTGGGGCCATGG + Intronic
999363649 5:151006942-151006964 TACTAAAAGCAGAGAGGCCTAGG - Intergenic
999642957 5:153690095-153690117 CTCCAGAAGCAGAGTACCCAGGG - Intronic
1000620372 5:163478722-163478744 CTGCAAAAGCAGGGTGGCCTGGG - Exonic
1001115654 5:168937190-168937212 CACCCAGAGCACAGAGGCCAAGG + Intronic
1001268311 5:170291275-170291297 CTTCAATAGCAGAGTGGCCCTGG + Intronic
1002900716 6:1407657-1407679 CTCCAAGAGAGGAGAAGCCAGGG + Intergenic
1003127075 6:3363860-3363882 TTCCAAAAGGAGACAGGACATGG + Intronic
1003960945 6:11208635-11208657 CTCCATCAGCACAGGGGCCATGG - Intronic
1004452916 6:15763897-15763919 TTCACAAAGCCGAGAGGCCAGGG + Intergenic
1006517461 6:34552943-34552965 CCCCAGGAGCAGAGAGGCCTGGG + Intronic
1010954170 6:82071386-82071408 CTACAAAACGAGAGAGGCGAAGG + Intergenic
1011211194 6:84958427-84958449 CTCCAAAAACAGCAAGGCCCTGG - Intergenic
1011418789 6:87151448-87151470 TTCCAAAAGCAGAGAAAACATGG - Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1015012176 6:128362975-128362997 CTGCCAAAACAGAGAAGCCACGG + Intronic
1015137515 6:129890562-129890584 CTCCAAATGCAGAGTGAGCAGGG + Intergenic
1015842024 6:137487466-137487488 CTCCAAAAGAAGTAATGCCAAGG + Intergenic
1016644826 6:146394515-146394537 CTCCAGAAGCAGAAAGGGCATGG - Intronic
1017732911 6:157333784-157333806 CTCCAAGAGCAGGCAGGCGAAGG + Intergenic
1018447161 6:163868112-163868134 CCCCCAGAGCAGGGAGGCCACGG + Intergenic
1018926347 6:168209522-168209544 CTCCGAGAGCAGTGGGGCCAGGG - Intergenic
1019840238 7:3434741-3434763 CCCCAAAAGCAGATAGGCCTGGG - Intronic
1020219251 7:6222215-6222237 TTCCAAAGGCAGAGATGTCAAGG + Intronic
1021175002 7:17440189-17440211 CTCACACAGCAGGGAGGCCATGG + Intergenic
1021502522 7:21346403-21346425 CTCCAAAGTCAGACAGGCCCAGG + Intergenic
1024578626 7:50783935-50783957 CTCCAAAAGGAGAGGTTCCACGG + Intronic
1024946039 7:54808272-54808294 CTACAAAAGCAAAAAGGACAGGG + Intergenic
1025094733 7:56088283-56088305 CTGCAATACCAGGGAGGCCAAGG - Intronic
1025702964 7:63836740-63836762 CTCCAAAAGCAGGGAAGGAAGGG - Intergenic
1027528553 7:79301326-79301348 TCACAAAAGCAGAGATGCCAAGG + Intronic
1027714575 7:81653752-81653774 CCCGAAAGGCAGATAGGCCAAGG - Intergenic
1028943386 7:96550757-96550779 GTACAAAAGCAGAGAAGGCAGGG - Intronic
1029458102 7:100681057-100681079 CCCCCAAAGCAGCGAAGCCAAGG + Exonic
1030279095 7:107751733-107751755 CTCCAAAATCCGAGAGGGAAAGG - Intronic
1031025640 7:116676814-116676836 CTCCAAAATCAGGGAGTCTATGG - Intronic
1032067067 7:128779507-128779529 CTCCAAAGTCATGGAGGCCACGG + Intergenic
1032722759 7:134564305-134564327 CTCCAAAACCACTGAGGCCTAGG + Intronic
1033115588 7:138621742-138621764 CTGCAACAGCAAAGAGGCTAGGG - Intronic
1033255091 7:139793682-139793704 TTACAAAAGCAGAGAGGAAAAGG + Intronic
1034644545 7:152633585-152633607 CTCCAGAAGCCGAGAGACCGCGG + Intergenic
1035062338 7:156078907-156078929 CTCCTAAAACAGAGAGGCCCAGG + Intergenic
1035098372 7:156375948-156375970 CTCAAGAAGCAGAGAAGGCATGG - Intergenic
1035262925 7:157673351-157673373 CTCCCAAAGCAGAAAAGCCACGG + Intronic
1035470704 7:159106980-159107002 ATCCAGGGGCAGAGAGGCCAGGG + Intronic
1036115704 8:5958726-5958748 GTCCAAAAACAGAGAGGAAAGGG + Intergenic
1037753666 8:21698145-21698167 GTCCAAAAGCACACAGGCCTAGG + Intronic
1038382156 8:27106145-27106167 CTCCATAATCAAAGTGGCCAAGG + Intergenic
1038520642 8:28229489-28229511 CCCCAAAAGGAAAGAGGTCAGGG + Intergenic
1041399877 8:57430899-57430921 CTCCAAAAACAAAAAGGCTAGGG - Intergenic
1041872855 8:62654865-62654887 CTCAAATAAGAGAGAGGCCATGG + Intronic
1043991927 8:86765783-86765805 CCCCAAAAGCTCAGAGGCTAGGG - Intergenic
1045482071 8:102600735-102600757 CTGCGAAAGCAGAGAAGCCTGGG - Intergenic
1047238256 8:123061483-123061505 CTACAAAGGCAGAGAGGCATAGG + Intronic
1048372626 8:133792783-133792805 CTCCAACAGCAGCGAGGACAAGG + Intergenic
1048693136 8:136989856-136989878 CTCCGAAACTGGAGAGGCCAGGG + Intergenic
1048936243 8:139359608-139359630 CTCTAAATGCACAGAGCCCAGGG + Intergenic
1049006511 8:139859056-139859078 CTCCTAGAGCATAGAGGACAGGG - Intronic
1049033390 8:140054165-140054187 CTCCAAAAGTGGGGAGGTCAAGG + Intronic
1049619468 8:143591534-143591556 CCCCAAAAGCAGAAACGCCTGGG + Intronic
1050140242 9:2510174-2510196 CTCCTCAAGGAGAGAGGGCAAGG - Intergenic
1052025475 9:23569254-23569276 CTCTAAAACCAGAGAGGCCTGGG + Intergenic
1056053657 9:82797658-82797680 CCACTAAAGCAGAGAGGCAATGG + Intergenic
1057416402 9:94867393-94867415 CTCTGAAAGCAAACAGGCCAGGG - Intronic
1057934853 9:99228452-99228474 CACCAAAGGCAAAGAGGCCAAGG - Intronic
1057971686 9:99564639-99564661 CTCCTAGAGGAGAGAGACCATGG + Intergenic
1059321523 9:113474210-113474232 CACAGGAAGCAGAGAGGCCAGGG + Intronic
1060047746 9:120354014-120354036 CTCCAACAGCTGAGAGCACAGGG + Intergenic
1061146083 9:128799481-128799503 CTTCAAAAGCAGAAAGCCCTGGG + Intronic
1061850888 9:133414594-133414616 CTCCATAAGGAGACAGGCCTTGG + Intronic
1061877105 9:133549677-133549699 CATCAAGAGCAGACAGGCCAAGG - Intronic
1062569237 9:137177206-137177228 CTCCAAGAGCAGAGCCGCCGAGG + Intronic
1186452940 X:9688220-9688242 ATCGAAGAACAGAGAGGCCACGG + Exonic
1188419018 X:29973574-29973596 CTCCATAAGCAAAGACCCCAGGG + Intergenic
1189684511 X:43549984-43550006 CTCCAACAGAAGTGAGGCCCAGG + Intergenic
1190003925 X:46716510-46716532 CTACAAAAGCACAGAGGGGAAGG + Intronic
1192180644 X:68913681-68913703 CTCCAGTGGCAGAGAGGCCGAGG + Intergenic
1192211849 X:69132841-69132863 CTCCAAAGGCATAGAGGCTGGGG - Intergenic
1192453179 X:71255964-71255986 CTCCACAAGCAGAGCAGCCAAGG - Intergenic
1195274632 X:103269670-103269692 CCCCAAAAGGAAAGAGGACAGGG - Intergenic
1195847109 X:109240662-109240684 GCCCAAAAGCACTGAGGCCACGG - Intergenic
1195913712 X:109915344-109915366 CCCCAAAAGCAAAGAGTCAAGGG + Intergenic
1196839674 X:119847832-119847854 ATCCAAAAGCAGTGAGAACAAGG + Intronic
1197434976 X:126416189-126416211 CTCCAACGGCAGAGACCCCAGGG + Intergenic