ID: 1176080026

View in Genome Browser
Species Human (GRCh38)
Location 20:63267840-63267862
Sequence TCTCTTGGTGTGTCCGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176080026_1176080034 -7 Left 1176080026 20:63267840-63267862 CCCTGGCCGGACACACCAAGAGA No data
Right 1176080034 20:63267856-63267878 CAAGAGACAGGGAGAGGGCGAGG No data
1176080026_1176080035 -6 Left 1176080026 20:63267840-63267862 CCCTGGCCGGACACACCAAGAGA No data
Right 1176080035 20:63267857-63267879 AAGAGACAGGGAGAGGGCGAGGG No data
1176080026_1176080036 -5 Left 1176080026 20:63267840-63267862 CCCTGGCCGGACACACCAAGAGA No data
Right 1176080036 20:63267858-63267880 AGAGACAGGGAGAGGGCGAGGGG No data
1176080026_1176080040 29 Left 1176080026 20:63267840-63267862 CCCTGGCCGGACACACCAAGAGA No data
Right 1176080040 20:63267892-63267914 CTCCAGCAACTCCCAGACAACGG No data
1176080026_1176080041 30 Left 1176080026 20:63267840-63267862 CCCTGGCCGGACACACCAAGAGA No data
Right 1176080041 20:63267893-63267915 TCCAGCAACTCCCAGACAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176080026 Original CRISPR TCTCTTGGTGTGTCCGGCCA GGG (reversed) Intronic