ID: 1176080188

View in Genome Browser
Species Human (GRCh38)
Location 20:63268666-63268688
Sequence CCTCACATGGGAAAGGCGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176080181_1176080188 -9 Left 1176080181 20:63268652-63268674 CCTCCTCTCTGTGTCCTCACATG 0: 3
1: 68
2: 495
3: 1389
4: 2804
Right 1176080188 20:63268666-63268688 CCTCACATGGGAAAGGCGTCGGG 0: 1
1: 0
2: 0
3: 11
4: 101
1176080178_1176080188 5 Left 1176080178 20:63268638-63268660 CCCAAGAGCCGGCACCTCCTCTC 0: 1
1: 0
2: 2
3: 13
4: 158
Right 1176080188 20:63268666-63268688 CCTCACATGGGAAAGGCGTCGGG 0: 1
1: 0
2: 0
3: 11
4: 101
1176080180_1176080188 -3 Left 1176080180 20:63268646-63268668 CCGGCACCTCCTCTCTGTGTCCT 0: 1
1: 0
2: 11
3: 67
4: 715
Right 1176080188 20:63268666-63268688 CCTCACATGGGAAAGGCGTCGGG 0: 1
1: 0
2: 0
3: 11
4: 101
1176080179_1176080188 4 Left 1176080179 20:63268639-63268661 CCAAGAGCCGGCACCTCCTCTCT 0: 1
1: 0
2: 0
3: 33
4: 277
Right 1176080188 20:63268666-63268688 CCTCACATGGGAAAGGCGTCGGG 0: 1
1: 0
2: 0
3: 11
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176080188 Original CRISPR CCTCACATGGGAAAGGCGTC GGG Intronic
904054363 1:27660218-27660240 CCTTGCCTGGGAAAGGCGACTGG + Intergenic
905913789 1:41671480-41671502 CCTGCCATGGGGAAGGCCTCAGG + Intronic
909263809 1:73530487-73530509 CCTCACATGAGAAATAGGTCTGG - Intergenic
910076057 1:83280190-83280212 CCTCTCATGGGAGAGGCTTAAGG + Intergenic
911216861 1:95204075-95204097 CCTCACAGGGCAGAGGGGTCAGG - Intronic
913132292 1:115851707-115851729 CTTCACATGAGAAAAGAGTCTGG + Intergenic
913660843 1:121005106-121005128 CTTCACATGTGAAAGGTCTCAGG + Intergenic
914012208 1:143788262-143788284 CTTCACATGTGAAAGGTCTCAGG + Intergenic
914165624 1:145172872-145172894 CTTCACATGTGAAAGGTCTCAGG - Intergenic
914650837 1:149696925-149696947 CTTCACATGTGAAAGGTCTCAGG + Intergenic
915121567 1:153632676-153632698 CCTCACATGGGTAAGGATGCTGG + Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1063112624 10:3049869-3049891 CCTCATTTTGGAGAGGCGTCCGG - Intergenic
1067512097 10:46904710-46904732 CTCCACATGGGAAAGACATCAGG + Intergenic
1067650149 10:48147114-48147136 CTCCACATGGGAAAGACATCAGG - Intergenic
1067761296 10:49049065-49049087 CATCACCTGGGAAAGGGTTCTGG + Intronic
1069155755 10:65029028-65029050 CCTTACATGGCAAAGGTGTTTGG - Intergenic
1070321774 10:75359849-75359871 CTTCACCTGGGAGAGGCTTCAGG + Intergenic
1070583572 10:77743474-77743496 CCTCACATGGTAAAGGGGTGAGG - Intergenic
1071205711 10:83274111-83274133 CCTCACATGGGAGAGCCCTGAGG - Intergenic
1075009173 10:118853278-118853300 CCTCACATGGCAGAGGGGACAGG + Intergenic
1080221984 11:29916735-29916757 CCTCACATGGGAAAGCTCTGAGG - Intergenic
1081341894 11:41938116-41938138 CCTCACATGGTCATGGAGTCTGG + Intergenic
1085621023 11:78038112-78038134 CCTTACATGGGAAGGGCCTCTGG - Intronic
1088434223 11:109793182-109793204 ACTCACACGGGAAAGGGGTGAGG - Intergenic
1089117998 11:116111808-116111830 CCTCCCCAGGGAAAGGGGTCCGG + Intergenic
1090331027 11:125932381-125932403 CCTCACATGGGCACGGGCTCAGG + Intergenic
1090351449 11:126110994-126111016 CCTCACATGGTAAGGGAGGCAGG + Intergenic
1112337181 13:98525290-98525312 CCTCAGATTGGAAAGGCCTGGGG + Intronic
1118277027 14:64394392-64394414 CCTCACAATGGAAAGGCCTCAGG - Intronic
1118318499 14:64739740-64739762 CCTCACATGGCAAAGGGGCAAGG + Intronic
1118375282 14:65171372-65171394 CCTCACTTAGGAAATGAGTCTGG + Intergenic
1119031767 14:71198197-71198219 CCACACAAGGGTAAGGCCTCAGG + Intergenic
1122036209 14:98951026-98951048 CATCACATGGGGATGGCCTCAGG - Intergenic
1125516189 15:40322733-40322755 CCTCACATGGGAAAGTGGGGAGG + Intergenic
1125732063 15:41898204-41898226 TCTCAGGTGGGAGAGGCGTCAGG - Exonic
1130921146 15:88345686-88345708 CCTCACATGGTAAAGGAGGAAGG + Intergenic
1131619282 15:94050137-94050159 CCTCACCTGGGCATGGCATCTGG - Intergenic
1135497138 16:22962618-22962640 TCTCACCTGGGAAAAGCCTCTGG - Intergenic
1144112467 17:12049428-12049450 ACTCACATGCGAAAGGAGCCAGG - Intronic
1146641380 17:34544217-34544239 ACTCACCTTGGAAAGGCTTCTGG - Intergenic
1149201084 17:54186640-54186662 CATCACTTGGAAAAGGCATCAGG - Intergenic
1149635267 17:58162202-58162224 CCTCACATGGCAAAGGAGCAAGG - Intergenic
1151064775 17:71136682-71136704 CCTCACAAGGGAGAGGCCTTTGG + Intergenic
1151733847 17:75926656-75926678 CCCCACCTGGGAGAGGCCTCTGG + Intronic
1153227507 18:2909734-2909756 CATCACTGGGGAAAGGCTTCTGG - Exonic
1160505781 18:79426312-79426334 CCTCGCCTGGGAAGGGCGTGAGG - Intronic
1161160105 19:2757083-2757105 CCACAGATGGGAAAGGAGTGGGG + Intronic
1161694392 19:5757955-5757977 CCTCTCAAGGGACAGGCGACAGG - Intronic
1164189208 19:22899794-22899816 ACTCACATGAGAAGGGTGTCAGG - Intergenic
929693117 2:44090933-44090955 CCTCTCATGTGAAGGGCTTCAGG + Intergenic
930901654 2:56514065-56514087 ACTAACATGGGAAAGGAGTCTGG + Intergenic
936756073 2:115714199-115714221 ACTCATATGGGAAAGGTGTTTGG + Intronic
937844547 2:126565264-126565286 CCTCTCAGGGGAAGGGCGTCGGG - Intergenic
937984026 2:127630569-127630591 CCTCCCAAGGGAAAGGAGACAGG + Intronic
943896158 2:193363167-193363189 CCTGACATGGGAAAGCAGTGGGG - Intergenic
946328599 2:218997476-218997498 CCCCACATGGGATGGGAGTCCGG - Intergenic
948193222 2:236076004-236076026 CCTCACATGGACCAGGGGTCTGG + Intronic
1168845512 20:941663-941685 TCTCACATGGGAAAGAATTCAGG + Intergenic
1171295059 20:24010122-24010144 CCTCACATGGCAAAGGGGTGAGG - Intergenic
1174998317 20:55598042-55598064 TCTCACATGGGAAGGGCATCTGG + Intergenic
1176080188 20:63268666-63268688 CCTCACATGGGAAAGGCGTCGGG + Intronic
1177486043 21:21757573-21757595 CCTCACATGGCAAAGGCAGAAGG + Intergenic
1181403634 22:22666961-22666983 CCTCACCTGGGAAATGCAGCTGG + Intergenic
1181405943 22:22685372-22685394 CCTCACCTGGGAAATGCTGCTGG + Intergenic
1181419559 22:22788590-22788612 CCTCACCTGGGAAATGCAGCTGG + Intronic
1181422261 22:22810378-22810400 CCTCACCTGGGAAATGCAGCCGG + Intronic
1182090517 22:27591504-27591526 ATTCACACGGGAAAGGTGTCAGG - Intergenic
949847687 3:8388623-8388645 CCTCACATCTGAGAGGAGTCAGG + Intergenic
950458143 3:13104776-13104798 CCTCACATGGGTCAGGGGCCAGG - Intergenic
950665258 3:14491461-14491483 GCTCACTGGGGAAAGGTGTCAGG + Exonic
954326937 3:49869064-49869086 CAGCACTTGGGAAAGGGGTCAGG - Intronic
954584404 3:51720965-51720987 CCTGACATGGGAAAGGGGGAGGG + Intergenic
962811604 3:138963235-138963257 CCTCTCCTGGGCCAGGCGTCAGG + Intergenic
969875612 4:10133682-10133704 CCTCACATGGGAACGTGTTCTGG + Intergenic
971447501 4:26766522-26766544 CCTCACATGGCATAGGTGTCTGG - Intergenic
974682001 4:65176779-65176801 CCTCACTTGGGAAGGGCAACAGG + Intergenic
982306541 4:153937652-153937674 CCTCACATGATAATGGCTTCAGG - Intergenic
989055453 5:37361962-37361984 CCTCACATGGCAGAGGGGTAGGG - Intronic
1001191572 5:169637283-169637305 CCTCCCGTGGGGAAGCCGTCAGG - Exonic
1002456737 5:179349591-179349613 CCTCATCTGGGAAAGGCCTTTGG + Intergenic
1006340326 6:33443215-33443237 ACTCCCCTGGGAGAGGCGTCCGG - Exonic
1013605033 6:111739497-111739519 CCTCTCATGAGACAGGCGGCTGG - Intronic
1016026687 6:139294573-139294595 CCTCACATGGCAGAGGGGTAAGG - Intergenic
1018972925 6:168540927-168540949 ACTCACCTGGGAAGGGCGTCTGG + Intronic
1019322837 7:423407-423429 CCTTACATGGGACAGGGGTGAGG - Intergenic
1022493455 7:30838165-30838187 CCTCAGATGAGAAAGGCAGCAGG - Intronic
1023288339 7:38642938-38642960 CCTCACAAGGGAGAGGCCTTTGG + Intergenic
1023288520 7:38644316-38644338 CCTCACATGGAAATGGCTGCTGG + Intergenic
1024207973 7:47179983-47180005 CGTCAGGTGGGAAAGGGGTCAGG - Intergenic
1024259049 7:47560259-47560281 CCTCACATGGTAGAGGGGTGAGG - Intronic
1027293773 7:76745053-76745075 CCTCTCATGGGAGAGGCTTAAGG + Intergenic
1029013492 7:97288211-97288233 CCTCACCTGGCAAAGGTGTGAGG - Intergenic
1030914332 7:115294087-115294109 CCTCACATGACAAAGGGGCCAGG + Intergenic
1032219987 7:129987369-129987391 ACTCCCATGGGAAAGGCACCAGG + Intergenic
1032321041 7:130887106-130887128 CCTCACAGGGGAAAGTGGTGGGG - Intergenic
1034589449 7:152127469-152127491 CCCCACGTGGGAAAGCCATCTGG + Intergenic
1034949835 7:155289838-155289860 CCTCACATGGTGAAGGGGCCAGG + Intergenic
1036189272 8:6655597-6655619 TCTCACATGGGAAAGAATTCAGG - Intergenic
1044806192 8:96010711-96010733 CCTCAGATGGGGAAGGCAACTGG + Intergenic
1046302279 8:112311576-112311598 CCTAACATGGTAGAGGTGTCTGG - Intronic
1047539258 8:125748393-125748415 CCTCACATGGTAAAGGGGCAAGG + Intergenic
1049010654 8:139884864-139884886 CCTCACAGGTGAAAGCTGTCGGG - Intronic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1059063249 9:111055376-111055398 CTTCACATGTGAAAGGGGTCAGG - Intergenic
1060096277 9:120793386-120793408 CCTCACAGGGGAGCGGCTTCCGG + Exonic
1060521936 9:124298930-124298952 CCTCACATGGGCAGGGCTCCAGG - Intronic
1186083695 X:5962779-5962801 CCTCACATGGAAAAAGGGTGAGG - Intronic
1186987567 X:15033267-15033289 CCTCACATGGCAGAAGCGTAAGG - Intergenic
1187843709 X:23514791-23514813 CCTCATATGAGAAAGCCCTCAGG - Intergenic
1193968563 X:88020901-88020923 TCTCACATGGGAAAGGATTCAGG + Intergenic
1201511156 Y:14764704-14764726 CCCCACATGGGAAAAGGGTGAGG + Intronic
1201912513 Y:19147213-19147235 CCTCACATGAGAAAGAATTCAGG - Intergenic