ID: 1176081363

View in Genome Browser
Species Human (GRCh38)
Location 20:63274913-63274935
Sequence CCCGTGAGTCACTGTGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176081351_1176081363 10 Left 1176081351 20:63274880-63274902 CCTAAACCTTGTTGCTGCTGTCC No data
Right 1176081363 20:63274913-63274935 CCCGTGAGTCACTGTGGTGGGGG No data
1176081352_1176081363 4 Left 1176081352 20:63274886-63274908 CCTTGTTGCTGCTGTCCCAGTAG No data
Right 1176081363 20:63274913-63274935 CCCGTGAGTCACTGTGGTGGGGG No data
1176081350_1176081363 11 Left 1176081350 20:63274879-63274901 CCCTAAACCTTGTTGCTGCTGTC No data
Right 1176081363 20:63274913-63274935 CCCGTGAGTCACTGTGGTGGGGG No data
1176081349_1176081363 29 Left 1176081349 20:63274861-63274883 CCATAGGTTTTCTCTTCACCCTA No data
Right 1176081363 20:63274913-63274935 CCCGTGAGTCACTGTGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176081363 Original CRISPR CCCGTGAGTCACTGTGGTGG GGG Intronic