ID: 1176081860

View in Genome Browser
Species Human (GRCh38)
Location 20:63277533-63277555
Sequence GACACGGCTGTGTGCACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 159}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176081860_1176081868 21 Left 1176081860 20:63277533-63277555 CCAGGTGTGCACACAGCCGTGTC 0: 1
1: 0
2: 1
3: 13
4: 159
Right 1176081868 20:63277577-63277599 CACATCTCCATCTGCTCACGGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1176081860_1176081866 19 Left 1176081860 20:63277533-63277555 CCAGGTGTGCACACAGCCGTGTC 0: 1
1: 0
2: 1
3: 13
4: 159
Right 1176081866 20:63277575-63277597 TTCACATCTCCATCTGCTCACGG 0: 1
1: 0
2: 2
3: 15
4: 202
1176081860_1176081869 22 Left 1176081860 20:63277533-63277555 CCAGGTGTGCACACAGCCGTGTC 0: 1
1: 0
2: 1
3: 13
4: 159
Right 1176081869 20:63277578-63277600 ACATCTCCATCTGCTCACGGGGG 0: 1
1: 0
2: 1
3: 4
4: 114
1176081860_1176081864 -6 Left 1176081860 20:63277533-63277555 CCAGGTGTGCACACAGCCGTGTC 0: 1
1: 0
2: 1
3: 13
4: 159
Right 1176081864 20:63277550-63277572 CGTGTCTGCCGTGGCGCTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 65
1176081860_1176081867 20 Left 1176081860 20:63277533-63277555 CCAGGTGTGCACACAGCCGTGTC 0: 1
1: 0
2: 1
3: 13
4: 159
Right 1176081867 20:63277576-63277598 TCACATCTCCATCTGCTCACGGG 0: 1
1: 0
2: 2
3: 24
4: 473
1176081860_1176081863 -7 Left 1176081860 20:63277533-63277555 CCAGGTGTGCACACAGCCGTGTC 0: 1
1: 0
2: 1
3: 13
4: 159
Right 1176081863 20:63277549-63277571 CCGTGTCTGCCGTGGCGCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176081860 Original CRISPR GACACGGCTGTGTGCACACC TGG (reversed) Intronic
900421830 1:2559099-2559121 GACAGGGCTGACGGCACACCTGG + Intronic
901231310 1:7642969-7642991 GCCATGGCTGAGTGCACTCCAGG + Intronic
902054050 1:13585486-13585508 GACACCGTTTTGTGCTCACCAGG + Intronic
902287681 1:15417137-15417159 TAAACGTCAGTGTGCACACCTGG - Intronic
902375773 1:16029316-16029338 GTCCTGGCTCTGTGCACACCTGG - Intronic
902380725 1:16051065-16051087 GTCCCAGCTCTGTGCACACCTGG - Intronic
902839999 1:19068523-19068545 CACACTGCTGGGTGCCCACCTGG + Intergenic
903751423 1:25623697-25623719 CACAAGGCTGGGTGCTCACCTGG - Intronic
904277649 1:29394808-29394830 GACAGGGCTGTGGTCACCCCAGG + Intergenic
905138200 1:35817598-35817620 TACAGGGCTGTCTTCACACCAGG - Intronic
905738981 1:40353038-40353060 GACATGGCTGTGGGCAACCCCGG - Intronic
907488875 1:54796207-54796229 GACACGCATGCGTGCATACCAGG + Intronic
908720339 1:67118814-67118836 GAAACAGCTGTCTGCAAACCAGG + Intronic
908879687 1:68716926-68716948 TACATGGCTCTGTGTACACCTGG - Intergenic
908952680 1:69580726-69580748 GACACGGTTGAGTACAAACCTGG + Intronic
909706032 1:78585863-78585885 GACACGACTGTGAGGAAACCTGG - Intergenic
913585605 1:120272431-120272453 GAAAGGGCAGTGTGCCCACCAGG - Intergenic
913622579 1:120625936-120625958 GAAAGGGCAGTGTGCCCACCAGG + Intergenic
914567611 1:148884290-148884312 GAAAGGGCAGTGTGCCCACCAGG - Intronic
914605211 1:149245955-149245977 GAAAGGGCAGTGTGCCCACCAGG + Intergenic
922252799 1:223864894-223864916 GGCAAGGCTCTGTGCTCACCTGG + Intergenic
923087505 1:230712781-230712803 GACGCGGCTGCGTGCAGACCTGG - Intronic
1063012875 10:2042514-2042536 GACAGGGCTGTGTCCTCACATGG + Intergenic
1063392481 10:5659451-5659473 GACACGGCTGTGTGCATGACGGG - Intronic
1072573782 10:96681174-96681196 GACACAGATGTGTGCACACACGG - Intronic
1075553198 10:123409297-123409319 GACCCTGCTGTCTGCACTCCTGG - Intergenic
1075964840 10:126602518-126602540 GCCCAGGCTGTGTGCCCACCAGG - Intronic
1076129303 10:128001883-128001905 GAGAAGGCTGTGGGCTCACCTGG + Intronic
1076806948 10:132863469-132863491 GAGACGGGTGTGTGCACACCAGG - Intronic
1077142390 11:1030329-1030351 CCCACGGCTGTGGGCACACGCGG + Exonic
1078426083 11:11252571-11252593 GGCAGGGCTGGCTGCACACCTGG + Intergenic
1079740348 11:24050971-24050993 AAGACAGCTGTGTGCAAACCAGG + Intergenic
1080078265 11:28179093-28179115 CACACACCTGTGTGCACACATGG + Intronic
1084314568 11:68337651-68337673 GACACGGCTGTGGGTGAACCAGG - Intronic
1085263986 11:75225532-75225554 GACACGCCTCTGTGGACACTGGG - Intergenic
1086794805 11:91086354-91086376 GACACTGCTGAGATCACACCTGG + Intergenic
1086878162 11:92122685-92122707 TACACAGCTGTATTCACACCTGG + Intergenic
1089065737 11:115660555-115660577 GCAACGGCTGTGTCCACTCCTGG + Intergenic
1091305550 11:134533641-134533663 GACACACATGTGTGCACACACGG - Intergenic
1092117966 12:6022913-6022935 GACAAGGCTGTGGCCACAACAGG + Intronic
1093475074 12:19545794-19545816 AACACTTCTGTGTCCACACCAGG + Intronic
1096072190 12:48781597-48781619 GACTGGGCAGTGTTCACACCTGG - Intronic
1100307203 12:93361745-93361767 GTCTTGGCTGTGAGCACACCTGG - Intergenic
1102357915 12:112255378-112255400 GACAAGGCTTTGGGGACACCTGG + Intronic
1103968864 12:124656948-124656970 GCCATGGCTGTGTTCCCACCAGG - Intergenic
1105780527 13:23702005-23702027 GCCATGGCTGTGGGGACACCTGG + Intergenic
1114234530 14:20812769-20812791 GACTGGCCTGTGAGCACACCAGG + Intergenic
1122564841 14:102645835-102645857 GGCAAGGCAGTGTGCACAGCTGG + Intronic
1122890170 14:104728584-104728606 GTCACAGGTGTGTGCACACTGGG + Intronic
1125191965 15:37003875-37003897 GAGACGGCTGTCTCTACACCGGG + Intronic
1125892623 15:43277598-43277620 GACACAGCACTGAGCACACCTGG - Intronic
1126007841 15:44275329-44275351 GACACAGCTGTGAGCAGAGCTGG - Intergenic
1126361373 15:47849689-47849711 GACATGGCAGTCTGCACGCCAGG + Intergenic
1126780759 15:52137292-52137314 GACCCTCCTGTGTGCACACCTGG - Intronic
1130981096 15:88812214-88812236 GACCCTGCTGTGTGCAAACCCGG - Intronic
1133341125 16:5036950-5036972 GATGCGGCTGTGTGCAGATCTGG + Intronic
1135112288 16:19699620-19699642 GGCACGGCTGTGCAGACACCAGG + Exonic
1135251730 16:20906190-20906212 GTCCCGGCTATGTGCACTCCTGG - Intronic
1136102131 16:28004074-28004096 GAGGCGCCTGTGTGCACAGCAGG + Intronic
1138100651 16:54249536-54249558 GAGACTGCTGTCTGCAGACCTGG + Intronic
1138385608 16:56633781-56633803 GACACAGCCGTGGGCACACTTGG - Exonic
1138434757 16:56991270-56991292 GACCCGGCCCTGTGGACACCCGG - Intronic
1138579108 16:57928154-57928176 GAGAAGGCTGTGTGTACAGCTGG - Intronic
1139509901 16:67421508-67421530 CACATGTGTGTGTGCACACCTGG - Intergenic
1140194600 16:72846069-72846091 AACACGGCTGTGAACACAACAGG + Intronic
1141160350 16:81625492-81625514 CACAGGCCTGTGTGCACACGAGG + Intronic
1142029631 16:87832063-87832085 GACACTGCTGTGTGGAGCCCAGG + Exonic
1143729640 17:8873921-8873943 GACATGGCTGTGGTCACAGCAGG - Intergenic
1143896526 17:10141003-10141025 GGCATAGCTGGGTGCACACCAGG - Intronic
1144629894 17:16865735-16865757 GCCATGGCTGTGTGCAGAACAGG + Intergenic
1144651536 17:17010382-17010404 GCCATGGCTGTGTGCAGAACAGG - Intergenic
1146185367 17:30720911-30720933 GACACAGGTGTGGGCTCACCTGG + Intergenic
1152575751 17:81140218-81140240 CTCACGGCAGAGTGCACACCAGG - Intronic
1152603770 17:81278713-81278735 GCCACAGCTGAGTCCACACCAGG + Intronic
1153763967 18:8357459-8357481 GACACGGAAATGTGCTCACCGGG - Intronic
1157442941 18:47724258-47724280 TACATGGCTGTGTTCACACAGGG - Intergenic
1158945190 18:62441943-62441965 GACAAGGCTCTGTGCTCGCCGGG - Intergenic
1160218596 18:76956201-76956223 GGCACAGCTGTGTGCCCCCCAGG + Intronic
1161008769 19:1949890-1949912 GACAAGGCAGTGGGGACACCGGG - Intronic
1162973406 19:14194785-14194807 GACACAGGTGTGGGCTCACCTGG - Intronic
1165146420 19:33733947-33733969 GACACCGCTGTCTGCTCACAGGG - Intronic
925350783 2:3199680-3199702 AACAGGGCTGTGTCCACATCTGG + Intronic
927195306 2:20542582-20542604 GACACAGATGTGTCCAAACCTGG + Intergenic
928279181 2:29929259-29929281 GGCCCAGCTGTGTGCACACCAGG + Intergenic
928691509 2:33804348-33804370 GACAGGGTTGTGTGCATACAGGG - Intergenic
929001054 2:37347088-37347110 TACACAGGTGTGTGCCCACCTGG - Intronic
930000838 2:46860505-46860527 GACAGGGGTGTCTGCACACCTGG + Intergenic
931590787 2:63880879-63880901 GACAGGCCTGTGGGCACTCCAGG - Intronic
933797216 2:85929228-85929250 GCCAGGGCTGTGCGCACACACGG - Intergenic
934188999 2:89767877-89767899 GCCGCGGCTTTGTGCACCCCCGG - Intergenic
934226597 2:90137599-90137621 GACACTGCTGTGAGCACCACTGG - Intergenic
934232609 2:90198869-90198891 GACACTGCTGTGAGCACCACTGG - Intergenic
934989463 2:98911244-98911266 GAGACTGCTGGGTGCACACTGGG + Intronic
938190514 2:129275542-129275564 GACACGACTGTGTGCATAACAGG + Intergenic
946018040 2:216619918-216619940 GAGAGGGCTGTGTGCGCAGCTGG + Intergenic
946688312 2:222293088-222293110 GCAACGGCTGTGAGCCCACCTGG + Intronic
948147899 2:235722156-235722178 CACACGTGTGTGTGCACATCTGG + Intronic
948855745 2:240729809-240729831 TACAGGACTGTGTGCACAGCAGG + Intronic
949037471 2:241822457-241822479 GAAACAGCTGTGTGGCCACCAGG + Intergenic
1172845560 20:37928068-37928090 GACACGGCTGTGGCCTCTCCAGG - Intronic
1174065391 20:47860887-47860909 GAGACAGCGGTGTGCACAGCTGG - Intergenic
1175072915 20:56349770-56349792 CAGAAGGCAGTGTGCACACCAGG + Intergenic
1175976775 20:62714558-62714580 CACGAGGCTGTGTGCACACCAGG - Intronic
1176081860 20:63277533-63277555 GACACGGCTGTGTGCACACCTGG - Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1178961926 21:37073358-37073380 GGCCCGGGTGAGTGCACACCCGG + Intronic
1180000869 21:44995016-44995038 GCCACTGCTGTCTGCACACCAGG + Intergenic
1180569401 22:16701327-16701349 GACAAGGCTGTGGCCACAACAGG + Intergenic
1181630476 22:24148556-24148578 GACAGGGCAGTGTCCACACTGGG - Intronic
1181957261 22:26596998-26597020 GACAGGGCTGTCTGCGGACCAGG - Intergenic
1184855953 22:47146866-47146888 GAGAGGGCTGTCTGCCCACCCGG + Intronic
1184886187 22:47345675-47345697 GAGAAGGCTGTGTGCACAGAAGG - Intergenic
1185313456 22:50169278-50169300 GCCACTGCTGTGAGCAAACCAGG - Intergenic
949504778 3:4717091-4717113 CACACGGCTGTCTGCACATGTGG + Intronic
951907831 3:27721684-27721706 CCCGCGGCTGTGTGCCCACCCGG - Exonic
954364048 3:50137071-50137093 GACACAGCTGAGTTCAGACCAGG - Intergenic
954371370 3:50171094-50171116 CACAGGGCTTTGTGCACAGCGGG + Intronic
961486647 3:127221747-127221769 GACACAGCTGTCTGCAAGCCCGG + Intergenic
962171327 3:133104607-133104629 GGCCCTGCTGTGTGCACAGCTGG + Intronic
963518630 3:146337926-146337948 GATACGGCTGTGTGAATGCCTGG + Intergenic
965464926 3:169017360-169017382 TAGACGGCTGTCTGCAAACCAGG - Intergenic
969532901 4:7739653-7739675 GACACGGCTGGGAGCACCCGCGG - Intronic
969884735 4:10205389-10205411 GAGATGGCTGTGTGCTCACACGG + Intergenic
976476623 4:85491546-85491568 CACACAGCTGTGTGGAAACCAGG + Intronic
980899567 4:138891808-138891830 GACAAGGCTGTGTGCCATCCGGG - Intergenic
982572645 4:157069518-157069540 GGCACGGTGGTGTGCACACGTGG - Intergenic
985530496 5:431162-431184 GACAGGGCTGTGCGCACACAGGG - Intronic
985788765 5:1914123-1914145 GGCACTGCTGTGTGCGCTCCCGG - Intergenic
985935496 5:3094422-3094444 GGGAGGGCTGTGTGCACACATGG - Intergenic
992000844 5:72434796-72434818 AACCAGGCTGTGTTCACACCTGG + Intergenic
993900549 5:93581516-93581538 GACTCGGCTGTGTGCCGCCCGGG + Intergenic
997998917 5:138608772-138608794 ACCACAGCTGTGTGCCCACCAGG + Intergenic
999887237 5:155936923-155936945 GCCCCGGGTGTGCGCACACCTGG + Intronic
1001809214 5:174614457-174614479 GACAGGGCTGTGTTCTCATCTGG + Intergenic
1001900284 5:175421339-175421361 GACACAGCTGTGAGAACACAGGG + Intergenic
1003973854 6:11324342-11324364 CACAGGGCAGTGTGCACAGCAGG - Intronic
1005927250 6:30453752-30453774 AACAGGGCTCTGTGCACACGGGG - Intergenic
1007255455 6:40525118-40525140 GACAAGGCAGTGTCCCCACCTGG + Intronic
1007635526 6:43297747-43297769 GACACACCTGTGATCACACCGGG - Intronic
1016995908 6:149962518-149962540 GAGGGGCCTGTGTGCACACCTGG - Intergenic
1018526906 6:164722569-164722591 AACAAGGCTGTGTACACTCCTGG - Intergenic
1018765405 6:166929044-166929066 GACACACCTGTGACCACACCAGG + Intronic
1019510337 7:1414500-1414522 GACTCTGCTGTGTGCAGGCCGGG - Intergenic
1019641708 7:2106886-2106908 GAGACAGCTGAGTGCAGACCTGG + Intronic
1019912561 7:4109666-4109688 GCCACGGCCTTGTGCCCACCAGG - Intronic
1020212776 7:6168288-6168310 GCCACGCCTGTGTACACAGCAGG + Intronic
1022112248 7:27239047-27239069 GCCACTGCTGGGTGCACCCCTGG - Intergenic
1029253578 7:99253685-99253707 GAAACAGCTGTGTACTCACCAGG + Intergenic
1031428806 7:121639910-121639932 GACAGTGCTGTGTACACAGCGGG - Intergenic
1034293725 7:149952019-149952041 GAGAAGGCTGTCTGCAAACCGGG - Intergenic
1034412059 7:150947026-150947048 GACCCGGCTGAGTGCAGACATGG - Exonic
1034727401 7:153350487-153350509 GACACTGCTGTGGGGACACCTGG + Intergenic
1034812341 7:154144834-154144856 GAGAAGGCTGTCTGCAAACCGGG + Intronic
1035333296 7:158110455-158110477 GACAGGGCCGTGTCCACAGCAGG + Intronic
1036709402 8:11068611-11068633 CACACAGCTGTGTGGGCACCAGG - Intronic
1037618797 8:20544887-20544909 GACACGGTGGTGTGCACCCGTGG + Intergenic
1044995991 8:97838671-97838693 GACACGGCGGTGAGAACACTTGG - Intronic
1046486399 8:114894234-114894256 GACCCTGCTGTCTGCAGACCAGG - Intergenic
1049128957 8:140819727-140819749 TACATTGCTGTGTGCTCACCAGG - Intronic
1049375752 8:142288272-142288294 GGCACGCCTCTGTGCACACACGG + Intronic
1049484304 8:142845265-142845287 GACACTGCTGTGAGCAGCCCAGG - Intronic
1060479508 9:124009752-124009774 CACACGTCTGTGTGAACACACGG + Intronic
1060860204 9:126947796-126947818 GACAAGGCTCAGAGCACACCTGG - Intronic
1061165118 9:128917725-128917747 GACTGGGCTGTGTGCACTCCAGG - Exonic
1061393670 9:130331778-130331800 GGGACGGCTGTGAGCACTCCTGG + Intronic
1186217644 X:7317038-7317060 GAAACAGCTGTTTGCAAACCAGG - Intronic
1186666543 X:11722603-11722625 GAGCCAGCTGTCTGCACACCTGG + Intergenic
1188385450 X:29551953-29551975 GACAAGTCTGTCAGCACACCTGG + Intronic
1190369435 X:49727057-49727079 CCCCTGGCTGTGTGCACACCCGG - Intergenic
1190375838 X:49787501-49787523 CACACAGCTCTGTGCACACGTGG + Intergenic
1191986085 X:66982663-66982685 GACACTGCTGTGTGCAGTCTTGG - Intergenic
1192924985 X:75747018-75747040 GGCCCGGGTGAGTGCACACCCGG - Intergenic
1193734515 X:85141097-85141119 GACACAGCTGTATGCAAAGCAGG + Intergenic
1200088613 X:153624059-153624081 GACTCGGCCCTGCGCACACCTGG + Intergenic