ID: 1176081888

View in Genome Browser
Species Human (GRCh38)
Location 20:63277668-63277690
Sequence ATGTGGGACGCATCCATGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176081888_1176081899 4 Left 1176081888 20:63277668-63277690 CCCGTCATGGATGCGTCCCACAT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1176081899 20:63277695-63277717 CTGCAGGAACGTCCCGGGTGGGG 0: 1
1: 0
2: 1
3: 9
4: 94
1176081888_1176081900 11 Left 1176081888 20:63277668-63277690 CCCGTCATGGATGCGTCCCACAT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1176081900 20:63277702-63277724 AACGTCCCGGGTGGGGTGACTGG 0: 1
1: 0
2: 0
3: 5
4: 139
1176081888_1176081893 -2 Left 1176081888 20:63277668-63277690 CCCGTCATGGATGCGTCCCACAT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1176081893 20:63277689-63277711 ATCCCACTGCAGGAACGTCCCGG 0: 1
1: 0
2: 2
3: 5
4: 106
1176081888_1176081904 22 Left 1176081888 20:63277668-63277690 CCCGTCATGGATGCGTCCCACAT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1176081904 20:63277713-63277735 TGGGGTGACTGGGTAGCACGAGG 0: 1
1: 0
2: 1
3: 9
4: 161
1176081888_1176081898 3 Left 1176081888 20:63277668-63277690 CCCGTCATGGATGCGTCCCACAT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1176081898 20:63277694-63277716 ACTGCAGGAACGTCCCGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 52
1176081888_1176081897 2 Left 1176081888 20:63277668-63277690 CCCGTCATGGATGCGTCCCACAT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1176081897 20:63277693-63277715 CACTGCAGGAACGTCCCGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 54
1176081888_1176081894 -1 Left 1176081888 20:63277668-63277690 CCCGTCATGGATGCGTCCCACAT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1176081894 20:63277690-63277712 TCCCACTGCAGGAACGTCCCGGG 0: 1
1: 0
2: 0
3: 11
4: 127
1176081888_1176081901 12 Left 1176081888 20:63277668-63277690 CCCGTCATGGATGCGTCCCACAT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1176081901 20:63277703-63277725 ACGTCCCGGGTGGGGTGACTGGG 0: 1
1: 0
2: 0
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176081888 Original CRISPR ATGTGGGACGCATCCATGAC GGG (reversed) Intronic
915210480 1:154305115-154305137 TTGAGGGACGCCTCCATGGCTGG - Intergenic
1074336772 10:112584519-112584541 ATGTTGGAAGCATACCTGACAGG - Intronic
1084208486 11:67609762-67609784 ATTTGGGATGCATGCAGGACTGG - Intronic
1087464325 11:98485917-98485939 GTGTAGGAAGCATCCATCACTGG - Intergenic
1094448453 12:30559004-30559026 CTGTGGCAGGCAGCCATGACTGG + Intergenic
1096711991 12:53464386-53464408 CTGTGGGAACAATCCATGACAGG - Intronic
1098568127 12:71957873-71957895 ATGTTGGACTCATCCCTGAATGG + Intronic
1098661590 12:73101220-73101242 ATGTTGGAGTCATCCAGGACGGG - Intergenic
1099509203 12:83512557-83512579 ATGTTGGAGGCATCCAGCACAGG - Intergenic
1102289466 12:111687092-111687114 ATATGGGACACATACATGACAGG + Intronic
1102524303 12:113500335-113500357 GTGTGGGAGGCAGCCAGGACTGG + Intergenic
1111919995 13:94400345-94400367 ATGTGGGAAGCAAATATGACAGG - Intronic
1118382158 14:65226239-65226261 ATGTGGGCCACATCCAGGAAAGG - Intergenic
1124691770 15:31829326-31829348 ATGTGGGAGGCCTCCCTGTCTGG - Intronic
1126306828 15:47268565-47268587 AGGTGGGATGCATCCTTGGCTGG - Intronic
1130121390 15:81050758-81050780 ATGTTGGAGGCATCCATATCAGG + Intronic
1132695190 16:1198906-1198928 ATGGTGGACGGAGCCATGACGGG - Intronic
1140981926 16:80118683-80118705 ATGTGGGAGGCAACCATACCAGG - Intergenic
1141298545 16:82792066-82792088 GTGTGGGACGGATCTGTGACTGG + Intronic
1145880268 17:28347925-28347947 ATGTGGGACACCTCCAAGGCTGG - Exonic
1146734025 17:35222002-35222024 ATCTGGGCTGGATCCATGACTGG + Intergenic
1152381073 17:79942501-79942523 ATGTGGGTGGTCTCCATGACAGG + Intronic
1161101411 19:2423807-2423829 ATGTGGGAGGCTGCCATGAGAGG + Intronic
938092227 2:128441336-128441358 ATGAGCGACGCAGTCATGACGGG - Intergenic
938118219 2:128616500-128616522 ATGTGGGACACATGCATGGAGGG + Intergenic
938958555 2:136320527-136320549 ATTTTGAAAGCATCCATGACTGG + Intergenic
945826537 2:214727102-214727124 ATGTGGGACAAATGCATTACTGG + Exonic
948270788 2:236671823-236671845 ATGGGAGACGAATCAATGACAGG - Intergenic
948507524 2:238439541-238439563 ATGTGGGGAGCAGCGATGACGGG - Intronic
948830433 2:240595966-240595988 ATGTGGGCCACATCCATGAAGGG - Intronic
1176081888 20:63277668-63277690 ATGTGGGACGCATCCATGACGGG - Intronic
949151681 3:775875-775897 AAGTGTGAAGCTTCCATGACAGG + Intergenic
961214554 3:125149103-125149125 ATGTGGCAGGCATCCATACCCGG + Intronic
967450361 3:189616277-189616299 AAGTGGGACAATTCCATGACTGG - Intergenic
974853435 4:67430677-67430699 AGGTAGGAAGCATCCATCACAGG - Intergenic
979446968 4:120825261-120825283 ATGTGGAAAGCATTCATGAGTGG + Intronic
982357290 4:154484941-154484963 CAGTGGAATGCATCCATGACAGG + Intronic
986700224 5:10400009-10400031 ATCTGGGACAAATCCATCACTGG + Intronic
997710533 5:136000522-136000544 ATGTGAGAAGCATCCAAGAACGG - Intergenic
1003760909 6:9177804-9177826 AGGTGGAACGTAACCATGACTGG - Intergenic
1011488228 6:87865393-87865415 ATGAAGGAGGCAGCCATGACAGG - Intergenic
1022037034 7:26544391-26544413 AGGTTGGATGGATCCATGACTGG + Intergenic
1022180060 7:27910522-27910544 TTGTGGGACGCATGCATTCCTGG - Intronic
1023918391 7:44607389-44607411 AGGTGGGACGCACCCAGGTCAGG - Intronic
1037754732 8:21703414-21703436 ATGTGGGACCCCTGCATGCCAGG - Intronic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1061779717 9:132988430-132988452 CAGTGGTACGCATCCATGCCTGG - Exonic
1198870670 X:141175129-141175151 ATCTGGGACACATCTATGAGTGG + Intergenic
1198928930 X:141831287-141831309 ATGAGGGACGCCTCCATGTGAGG + Intergenic
1199621963 X:149709872-149709894 ATGTTGGACGCATTCATGTCAGG + Intronic