ID: 1176083393

View in Genome Browser
Species Human (GRCh38)
Location 20:63285067-63285089
Sequence GAGGAGCCCAGGCCCCGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 403}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176083393_1176083406 14 Left 1176083393 20:63285067-63285089 CCTCCTCGGGGCCTGGGCTCCTC 0: 1
1: 1
2: 2
3: 39
4: 403
Right 1176083406 20:63285104-63285126 TGGTCCCTTCCCCTGGCCTAGGG 0: 1
1: 1
2: 2
3: 23
4: 234
1176083393_1176083402 7 Left 1176083393 20:63285067-63285089 CCTCCTCGGGGCCTGGGCTCCTC 0: 1
1: 1
2: 2
3: 39
4: 403
Right 1176083402 20:63285097-63285119 CCCCAGCTGGTCCCTTCCCCTGG 0: 1
1: 0
2: 4
3: 62
4: 510
1176083393_1176083405 13 Left 1176083393 20:63285067-63285089 CCTCCTCGGGGCCTGGGCTCCTC 0: 1
1: 1
2: 2
3: 39
4: 403
Right 1176083405 20:63285103-63285125 CTGGTCCCTTCCCCTGGCCTAGG 0: 1
1: 0
2: 3
3: 50
4: 434
1176083393_1176083397 -6 Left 1176083393 20:63285067-63285089 CCTCCTCGGGGCCTGGGCTCCTC 0: 1
1: 1
2: 2
3: 39
4: 403
Right 1176083397 20:63285084-63285106 CTCCTCTTGGACCCCCCAGCTGG 0: 1
1: 0
2: 3
3: 19
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176083393 Original CRISPR GAGGAGCCCAGGCCCCGAGG AGG (reversed) Intronic