ID: 1176083393

View in Genome Browser
Species Human (GRCh38)
Location 20:63285067-63285089
Sequence GAGGAGCCCAGGCCCCGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 403}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176083393_1176083402 7 Left 1176083393 20:63285067-63285089 CCTCCTCGGGGCCTGGGCTCCTC 0: 1
1: 1
2: 2
3: 39
4: 403
Right 1176083402 20:63285097-63285119 CCCCAGCTGGTCCCTTCCCCTGG 0: 1
1: 0
2: 4
3: 62
4: 510
1176083393_1176083406 14 Left 1176083393 20:63285067-63285089 CCTCCTCGGGGCCTGGGCTCCTC 0: 1
1: 1
2: 2
3: 39
4: 403
Right 1176083406 20:63285104-63285126 TGGTCCCTTCCCCTGGCCTAGGG 0: 1
1: 1
2: 2
3: 23
4: 234
1176083393_1176083397 -6 Left 1176083393 20:63285067-63285089 CCTCCTCGGGGCCTGGGCTCCTC 0: 1
1: 1
2: 2
3: 39
4: 403
Right 1176083397 20:63285084-63285106 CTCCTCTTGGACCCCCCAGCTGG 0: 1
1: 0
2: 3
3: 19
4: 204
1176083393_1176083405 13 Left 1176083393 20:63285067-63285089 CCTCCTCGGGGCCTGGGCTCCTC 0: 1
1: 1
2: 2
3: 39
4: 403
Right 1176083405 20:63285103-63285125 CTGGTCCCTTCCCCTGGCCTAGG 0: 1
1: 0
2: 3
3: 50
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176083393 Original CRISPR GAGGAGCCCAGGCCCCGAGG AGG (reversed) Intronic
900088082 1:908218-908240 GAGCAGGCCAGGCCCACAGGAGG + Intergenic
900143822 1:1149619-1149641 GAGGAGGGCAGGTCCCGTGGTGG + Intergenic
900399623 1:2467623-2467645 GAAGAGCCTGGGCCCCCAGGTGG + Intronic
900406775 1:2496241-2496263 GAGGAGGCCAGGGTCCAAGGGGG - Intronic
900432756 1:2610778-2610800 GAGGTCCCCAGCCCCAGAGGTGG - Intronic
900539721 1:3196745-3196767 GAGGAGTCCAGCCCAGGAGGAGG + Intronic
900553688 1:3269364-3269386 GAGGAGGACAGTCCCAGAGGAGG + Intronic
900553693 1:3269380-3269402 GAGGAGGACAGTCCCGGAGGAGG + Intronic
900553710 1:3269455-3269477 GAGGAGGACAGTCCCAGAGGAGG + Intronic
900553737 1:3269563-3269585 GAGGAGGACAGTCCCGGAGGAGG + Intronic
900553752 1:3269626-3269648 GAGGAGCACAGTCCCGGAGGAGG + Intronic
900553769 1:3269703-3269725 GAGGAGCACAGTCCCGGAGGAGG + Intronic
900553782 1:3269762-3269784 GAGGAGGACAGTCCCAGAGGAGG + Intronic
900553863 1:3270131-3270153 GAGGAGTACAGTCCCGGAGGAGG + Intronic
900553881 1:3270204-3270226 GAGGAGGACAGTCCCAGAGGAGG + Intronic
900553894 1:3270262-3270284 GAGGAGCACAGTCCCGGAGGAGG + Intronic
900553925 1:3270402-3270424 GAGGAGGACAGTCCCAGAGGAGG + Intronic
900553980 1:3270663-3270685 GAGGAGGACAGTCCCAGAGGAGG + Intronic
900554007 1:3270770-3270792 GAGGAGGACAGTCCCAGAGGAGG + Intronic
901133874 1:6980291-6980313 GAGGAGCCCCGGGCCTAAGGAGG - Intronic
902369226 1:15994878-15994900 GCAGAGCCAAGGCCCTGAGGTGG - Intergenic
902402834 1:16167492-16167514 AAGGAGCCCGGGCCACGTGGAGG + Intergenic
902682108 1:18050812-18050834 GAGGAGCCCAGGGACCCAGCTGG - Intergenic
902716945 1:18279556-18279578 GGGGAGCCAAGGCCCAGAGAGGG + Intronic
902753316 1:18532581-18532603 GAAGAGGCCAGGACCCGAGCTGG - Intergenic
902768309 1:18631243-18631265 CCGGAGACCAGGCCCCGCGGCGG - Exonic
902822541 1:18951986-18952008 GAGGAGCTGAGGCCCAGAGAGGG + Intronic
902873668 1:19328609-19328631 GAGGGGCTCAAGCTCCGAGGCGG - Exonic
902881047 1:19371960-19371982 GGGGAGCCCAGGCCGGGGGGTGG + Intronic
903121208 1:21218027-21218049 GGGGAAGCCAGGCCCCGAGACGG - Intronic
903364087 1:22795156-22795178 GAGGAACCGAGGCCCAGAGAGGG + Intronic
903661424 1:24981151-24981173 GAAGGGCCCAGGCCCTGAGGAGG + Intergenic
903760638 1:25695837-25695859 GAAGAGACGAGGCCCAGAGGAGG - Intronic
903785621 1:25859333-25859355 GAGGCGGACAGGCCCCGAGGAGG - Exonic
903832666 1:26184074-26184096 GGGGAGTCCAGGACCTGAGGGGG - Exonic
904094497 1:27966589-27966611 GAGGAGCCCAGGCCCAGGAGCGG - Exonic
904296830 1:29524706-29524728 GCGGAGCCCAGGCCCCTCAGAGG - Intergenic
904339372 1:29824238-29824260 AAGGAGCCCTGGCCTCGAGTGGG + Intergenic
904360439 1:29967768-29967790 CAGGAGCCCAGGCCCCTGGAAGG - Intergenic
904376694 1:30086203-30086225 GCAGAGCCCAGGCTGCGAGGCGG - Intergenic
905175641 1:36133913-36133935 GAGGAGGCCTGGACCCAAGGTGG + Intergenic
905670735 1:39788707-39788729 GAGTAGCCCCGGCCTCGAGGCGG - Exonic
905850329 1:41269334-41269356 CAAGTGCCAAGGCCCCGAGGTGG - Intergenic
906240535 1:44239652-44239674 GGGCACCCCAGGCCCCCAGGAGG - Intronic
906264440 1:44417788-44417810 GGGGAGGCCAGGCCACGGGGTGG + Intronic
906835009 1:49073937-49073959 GAGATGCCCAGCCCACGAGGTGG + Intronic
907183631 1:52591901-52591923 GAGAAGCCAAGGCCCAAAGGAGG + Intergenic
907483169 1:54758572-54758594 GATGAGCCCAGGCCCCGCTTTGG - Exonic
907487472 1:54787707-54787729 GAGGACCCCCGCCACCGAGGTGG - Exonic
907704271 1:56819436-56819458 GAGGAGCCTCGGCCCAGATGGGG - Intronic
909485024 1:76162887-76162909 GAGGTGACCAGGCCCAGAGCTGG + Intronic
911219790 1:95234385-95234407 GGGGTGCCCAGGCTCCGTGGTGG - Intronic
912491695 1:110066032-110066054 GTGGAGGCCTGGCCCTGAGGAGG + Intronic
913965198 1:143371017-143371039 GTGAAGCCCAAGCCCCTAGGTGG - Intergenic
914059574 1:144196619-144196641 GTGAAGCCCAAGCCCCTAGGTGG - Intergenic
914119576 1:144769752-144769774 GTGAAGCCCAAGCCCCTAGGTGG + Intergenic
915103973 1:153520915-153520937 GAGGTAGCCAGGCACCGAGGTGG + Intergenic
915285027 1:154847043-154847065 GAGGAGCCCAGGGCTCAGGGAGG - Intronic
915448592 1:155989311-155989333 GGGATGCCCAGGCCCCAAGGAGG - Intronic
915512250 1:156392708-156392730 GAGAAGCCCAAGCCCCCAGCTGG - Intergenic
916179288 1:162070030-162070052 GGGGAGCCCTGGCCGCGCGGCGG - Exonic
917629204 1:176876555-176876577 GAAGACCCCATGCCCCGTGGTGG - Exonic
917966982 1:180185128-180185150 GAGGAGACCTTGCCCTGAGGAGG + Intronic
918081965 1:181214689-181214711 CAGGTGCCAAGGCCCTGAGGAGG - Intergenic
919838108 1:201590610-201590632 GAGGTGCCCAGGCCCAGCTGAGG + Intergenic
920244470 1:204577311-204577333 GAGGAAACCAGGCCCAGAGAAGG - Intergenic
920695249 1:208176866-208176888 GAGGATCCCAGGACTCAAGGAGG - Intronic
922097001 1:222451076-222451098 GCGGAGCCCAGGGCCCCAGTAGG + Intergenic
922590221 1:226769943-226769965 GAGGAGCCCAGGACTGTAGGTGG + Intergenic
922707486 1:227796939-227796961 CAGCAGGCCAGGCCTCGAGGTGG - Intergenic
923359681 1:233198716-233198738 GGGGAGGCCAGGCCAGGAGGTGG + Intronic
923531962 1:234818811-234818833 GGGGAGCCCAGGGCAGGAGGAGG + Intergenic
923540111 1:234882698-234882720 GAGGAGCTCAGGGCCTGAGGTGG - Intergenic
923750133 1:236739797-236739819 GAGGGGCCAAGGCCATGAGGAGG - Intronic
924669989 1:246114387-246114409 GAAGAGGCCAGCCCCCGATGGGG + Intronic
924706798 1:246508877-246508899 GCAGAGCCAAGGCCCTGAGGTGG + Intergenic
924732449 1:246724389-246724411 AGCGAGCCCAGGCCCCGGGGCGG - Exonic
1063026163 10:2180803-2180825 GAGCAGCCAATGCCCCAAGGTGG - Intergenic
1063177430 10:3564492-3564514 GAGGAGCTCAGGCCCCGAAGAGG - Intergenic
1066180491 10:32957604-32957626 GAGGAGACCAGTCCCCGTCGCGG + Intronic
1067051275 10:43022787-43022809 CAAGAGCACAGGCCCTGAGGTGG + Intergenic
1067275000 10:44826480-44826502 GAGGAGAGCAGGGCCAGAGGAGG + Intergenic
1069180763 10:65355484-65355506 GGGTAGCTCAGGCCCCCAGGAGG - Intergenic
1069750453 10:70742010-70742032 GTGGAGCCCAGGCTCCAGGGAGG - Intronic
1069780934 10:70954925-70954947 GGGAAGCCAAGGCCCAGAGGGGG + Intergenic
1069959316 10:72070287-72070309 GAGGAGCCCAGGCCCCAGGTAGG - Intronic
1070509433 10:77147011-77147033 GAGGGGGCCAGGCACAGAGGAGG + Intronic
1070559264 10:77553564-77553586 GAGGTGCCCAGGCCCTGACTGGG - Intronic
1070891252 10:79943598-79943620 GAGGAGGCCAGGCCTCCATGGGG + Intronic
1071055342 10:81503132-81503154 CAGGAGCCCAGGCGGCGGGGAGG - Intergenic
1073489236 10:103841687-103841709 CAGGTGCCAAGGCCCCGAGGTGG - Intronic
1074509722 10:114101237-114101259 GGGGAGCCCAGGCTCTGCGGAGG - Intergenic
1075465656 10:122648477-122648499 CAGGAGCCCAGGAGCCCAGGAGG + Intergenic
1075477609 10:122749936-122749958 GAGGTGCTCAGGCCGCGTGGAGG + Intergenic
1075575904 10:123577301-123577323 GGGGAGCCCAGGCATGGAGGAGG + Intergenic
1076694534 10:132240754-132240776 GAGGAGCCCAGCCAGCCAGGGGG + Intronic
1076734771 10:132453673-132453695 CAGGACCCCAGGCACAGAGGTGG + Intergenic
1076783216 10:132735850-132735872 GAGGCTCTCAGACCCCGAGGTGG + Intronic
1077095742 11:798319-798341 GGGGAGCCGAAGCCCGGAGGAGG - Exonic
1077266240 11:1652090-1652112 GGGGAGCCCAGGCTCCAAGGTGG - Intergenic
1077422678 11:2460383-2460405 CAGGTGCCCAAGCCCCCAGGTGG + Intronic
1077915134 11:6606734-6606756 TAGAAGTCCAGGCCCTGAGGTGG + Intronic
1081580570 11:44348863-44348885 GAGAAATCCAGGCCCCGAGTCGG + Intergenic
1083302627 11:61746758-61746780 GAGTCGCCCAGGCCCCTGGGAGG - Exonic
1083307696 11:61769666-61769688 GGGGTGCCCTGGCCCCCAGGTGG + Intronic
1083332057 11:61903312-61903334 GAGGAGCCCTGGCTCTGATGTGG - Intronic
1083540111 11:63506552-63506574 GAAGAGCCCAGAGACCGAGGAGG - Intronic
1084084653 11:66849448-66849470 GAGGAGCCAAGGCCCAGTGTGGG - Intronic
1084180936 11:67445497-67445519 GATGTGCCCAGGCCTCGGGGTGG - Intergenic
1084216542 11:67650017-67650039 GTGGAGCCAAGGCCCAGAGAGGG - Intronic
1084539560 11:69777312-69777334 GAGGAGGCCAGGGCCTGCGGAGG - Intergenic
1084797639 11:71519069-71519091 AAGGAGACGAGGCCCCGAGGAGG - Intronic
1085449261 11:76622287-76622309 GAGGCGCTGAGGCCCAGAGGTGG + Intergenic
1086322497 11:85664935-85664957 AAGGATCCCAGGCCCCAGGGCGG + Exonic
1087104204 11:94394167-94394189 GATGAGCTCAGGTCCCAAGGAGG - Intronic
1089084745 11:115807388-115807410 CAGGAGCCCAGGACCTGGGGAGG - Intergenic
1089298376 11:117483098-117483120 CAGGTGCTCAGGCCCAGAGGAGG - Intronic
1090408944 11:126494721-126494743 GTGGGTCCCAGGGCCCGAGGAGG - Intronic
1091303442 11:134522615-134522637 GAGGAGCACAGGCACTGATGAGG + Intergenic
1091312350 11:134583675-134583697 GAGGTGCCCAGGCACAGAGGAGG + Intergenic
1202811243 11_KI270721v1_random:28140-28162 CAGGAGCCCAGGACCCGGGATGG + Intergenic
1091560492 12:1609176-1609198 CAGGAGCCCAGGATCCCAGGAGG - Intronic
1091563120 12:1629670-1629692 GAGGCGACCAGGTCCCGAGTAGG - Intronic
1091624332 12:2110896-2110918 GGGAGGCCCAGGCCCGGAGGTGG + Intronic
1091656022 12:2347619-2347641 CAGGAGCCCAGGACCCGTGGGGG + Intronic
1091853411 12:3719326-3719348 GAGGAGCCCGAGGCCCAAGGAGG - Intronic
1092231191 12:6776341-6776363 GAGGAGGCCAGGTTTCGAGGTGG - Intronic
1093125388 12:15322544-15322566 GAGGACCCCGGGCGCAGAGGAGG + Exonic
1095446636 12:42288717-42288739 GAGAACCCCAGGGGCCGAGGAGG + Intronic
1096115851 12:49054606-49054628 GGGGAGCCCAGGGCCCAATGAGG - Exonic
1096677496 12:53233525-53233547 GAGGACACCTGGCCCCCAGGGGG - Intergenic
1102370838 12:112381735-112381757 GCGGGCGCCAGGCCCCGAGGAGG + Intronic
1102492594 12:113298001-113298023 GGGGAGTCAAGGCCCCGAGGTGG + Exonic
1102830914 12:115998507-115998529 AAGGAACCAAGGCCCCAAGGGGG - Intronic
1103276036 12:119712554-119712576 GAGGAGCCCCGCCCTGGAGGTGG - Intronic
1103612112 12:122130170-122130192 AAGGAACCCTGGCCCAGAGGGGG - Intronic
1103972822 12:124682627-124682649 GGGGAGCACAGGCCCGGAGCAGG - Intergenic
1104848044 12:131856914-131856936 GAGGAGCCCAGGCCCCATGGAGG - Intergenic
1106246578 13:27954686-27954708 AAGGAGCCCGGGCCCCGCGGCGG + Intergenic
1107825702 13:44327208-44327230 GATGAGCCCAGGCTGAGAGGAGG + Intergenic
1108409907 13:50134964-50134986 GAGGAGCCTGGGCCCTGAGAGGG + Intronic
1111951771 13:94713493-94713515 GTGGAGCCCAGGACTCGGGGAGG + Intergenic
1113775663 13:112943597-112943619 CAGGCGCCCAGGCGCAGAGGAGG + Intronic
1117119518 14:52552930-52552952 GAGGAGCCGAGACCCCCGGGGGG + Intergenic
1117546020 14:56795233-56795255 GAGGAGCGCTGGCCCCGCGAAGG + Intergenic
1119440866 14:74627968-74627990 GAGGAGCCCAAGGCCAGGGGTGG - Intergenic
1119804705 14:77475263-77475285 GAAGAGCCCAGCTCCCAAGGAGG + Exonic
1120190831 14:81437773-81437795 GAGGAGCCCAAGACCCCAAGAGG + Intergenic
1122252869 14:100452564-100452586 CAGGTGCCCAGGCCTTGAGGGGG + Intronic
1122276051 14:100591337-100591359 AAGGAGCCCAGACCCCCAGGTGG - Intergenic
1122325589 14:100879323-100879345 GAGGAGGCCAAGGCCAGAGGTGG + Intergenic
1122550221 14:102545273-102545295 GGGGAGACGAGGCCCAGAGGAGG - Intergenic
1122603015 14:102930521-102930543 GCCGAGTCCCGGCCCCGAGGAGG - Intronic
1122887836 14:104718405-104718427 GTGGGGCCCAGGGCCCGACGTGG + Intronic
1123411946 15:20067880-20067902 GGGCTGCCCAGGCCCCGGGGAGG + Intergenic
1123521290 15:21074999-21075021 GGGCTGCCCAGGCCCCGGGGAGG + Intergenic
1123582907 15:21731740-21731762 GAGGAGCTCAGGACACCAGGGGG - Intergenic
1123619557 15:22174336-22174358 GAGGAGCTCAGGACACCAGGGGG - Intergenic
1124340865 15:28888470-28888492 GAGGAGCTGAGGCCTCGAGGGGG - Intronic
1124966231 15:34435151-34435173 GAGGAGCTGAGGCCTGGAGGGGG + Intronic
1124982833 15:34581234-34581256 GAGGAGCTGAGGCCTGGAGGGGG + Intronic
1125907956 15:43410786-43410808 GAGGAGCTCAGGCACCGCCGAGG + Intronic
1127982747 15:64046467-64046489 GAGCAGCCTAGGAGCCGAGGGGG + Intronic
1128322560 15:66703482-66703504 GAGGCGCCCAGGGCGCGGGGAGG + Exonic
1128374474 15:67065537-67065559 GGGGAGCCCCGGCGGCGAGGGGG + Intronic
1128721779 15:69955486-69955508 GAGGAGCCCAGGCTCCACGGTGG + Intergenic
1128754533 15:70172409-70172431 GTGGAGCCCAGGCCCAGATATGG - Intergenic
1128996967 15:72304535-72304557 GGGGAGCCCAGGCCCAGAAGAGG - Intronic
1130258338 15:82336254-82336276 GAGGAGCCCAAGGCCCTAAGAGG + Intergenic
1130890804 15:88132463-88132485 TAGGAGCCCAGGCCACCAGATGG + Intronic
1130987244 15:88852488-88852510 GAGGAGGCCTGGCCCAGAAGAGG - Intronic
1132252655 15:100345836-100345858 GAGGAGCCCAGAGCCCAGGGTGG - Intergenic
1132854484 16:2038705-2038727 GGAGAGCCCAGGCCCCCAGCAGG - Exonic
1132925119 16:2425275-2425297 GAGGAGAGCAGGCCCAGAGAGGG + Intergenic
1133009884 16:2905113-2905135 GAGGTGCGCAGGCCGTGAGGCGG + Intergenic
1133287349 16:4696796-4696818 GTGCAGCCCAGGCCCAGTGGGGG - Exonic
1133316087 16:4884976-4884998 CAGGAGGCGAGGCCCCCAGGTGG - Exonic
1133325137 16:4937401-4937423 GAGGCGCGCCGGGCCCGAGGAGG - Intronic
1133771120 16:8867758-8867780 GAGGACCCCGAGCCCAGAGGAGG + Intronic
1136005028 16:27323546-27323568 GAGAAGCCGAGGCCCAGAGAGGG - Intronic
1136428491 16:30184194-30184216 GGGGAGCCCCGGACCAGAGGTGG - Intronic
1137398790 16:48136252-48136274 GAGGAGCAGAGGCCTGGAGGTGG - Intronic
1137584862 16:49658329-49658351 AAGGAGCCCGGGGCCTGAGGAGG + Intronic
1137670020 16:50273420-50273442 GAGGAGCTCATGCCAGGAGGAGG - Intronic
1138413582 16:56858474-56858496 GAGGAGCCACAGCCCAGAGGAGG + Intergenic
1138584461 16:57960976-57960998 GTTGAGGCCTGGCCCCGAGGTGG - Intronic
1139142815 16:64288484-64288506 GAGGAGCCCAGTCTGCTAGGTGG + Intergenic
1139961744 16:70721934-70721956 CAGGACCCCAGGCCCGGTGGAGG + Intronic
1141149352 16:81553283-81553305 GAGCAGGCCATGCCCCCAGGAGG + Intronic
1141181589 16:81756579-81756601 GGGGAGGCCAGGCACAGAGGTGG + Intronic
1141489530 16:84362838-84362860 CAGGAGCTAAGGCCCGGAGGGGG - Intergenic
1142027964 16:87824504-87824526 GTGAAGCCCATGCCCCGCGGTGG + Intergenic
1142149441 16:88506184-88506206 GAGGAGACCAGGGCAGGAGGTGG + Intronic
1142891732 17:2948302-2948324 GAGGAGCCCAGGGCCAGGGCAGG + Intronic
1142994661 17:3753577-3753599 GAGCAGCCCAGGCCCCACAGCGG + Intronic
1143137031 17:4717806-4717828 CAGGAGCCCAGGCCCCGTGCGGG + Intronic
1143187512 17:5019597-5019619 GAGGAGCCCAGGCCCCACCAGGG + Intronic
1143679642 17:8466958-8466980 GAGGAGCCCAGACCAGGAGGAGG - Exonic
1144149689 17:12431260-12431282 GTGGAGCCCAGGAGCTGAGGTGG - Intergenic
1144262193 17:13532547-13532569 GGAGAGTCCAGGGCCCGAGGGGG + Intronic
1144672832 17:17142596-17142618 GAGGACACGAGGCCCTGAGGTGG - Intronic
1144729968 17:17520594-17520616 CAGACGCACAGGCCCCGAGGCGG + Intronic
1144777368 17:17791589-17791611 GTGTGGCCCAGGCCCCCAGGAGG - Intronic
1145238980 17:21228508-21228530 GAGAAACCAAGGCCCCAAGGTGG - Intergenic
1145323600 17:21781497-21781519 GAGGGTGCCAGGCCCCGAGAGGG + Intergenic
1145762161 17:27431239-27431261 GCAGAGCCAAGGCCCCGAGGTGG - Intergenic
1147000452 17:37358873-37358895 GTGGAGCCCAGGCCGCGTGCGGG + Intronic
1148764426 17:50028928-50028950 GAGGAGCCCATGGCCAGAGAGGG - Intergenic
1148777174 17:50102250-50102272 GAGGAGCCCTGGCCCTGTGAGGG + Intronic
1148895168 17:50835340-50835362 GAGGGGGCCCGGCCCCAAGGAGG + Intronic
1149001374 17:51761128-51761150 GAGGATACCAGGCTCTGAGGAGG + Intronic
1149678693 17:58488455-58488477 GAGGTGCCCACGCCGCGTGGCGG - Intergenic
1149760128 17:59221183-59221205 GAAGAGCCGAGGCGACGAGGAGG + Intronic
1150392574 17:64798488-64798510 GTGGAGGCCAGGCTCTGAGGGGG - Intergenic
1150488567 17:65560244-65560266 GAGGGGCCCGGGCCGGGAGGAGG + Intronic
1150644873 17:66971729-66971751 GGCGAGCCGAGGCCCCGAGCAGG + Intronic
1151397975 17:73837229-73837251 GAGGAGGCCAGAACCCCAGGGGG - Intergenic
1151451103 17:74198835-74198857 GAGGATCCCAGGCCCCTACTTGG - Intergenic
1151705418 17:75764713-75764735 GAGGAGCCCCAGCCCCCAGAGGG + Intronic
1152228288 17:79102636-79102658 GAAGAGACCAGGCCCCAAGGAGG - Intronic
1152234196 17:79130053-79130075 GAGGTGCCCAGGCCTGGAGCAGG + Intronic
1152294183 17:79457105-79457127 CAGGAGCCCATGCCCTGGGGAGG - Intronic
1152471136 17:80490683-80490705 GAGCAGCTCAGCCCACGAGGAGG + Intergenic
1152663174 17:81552354-81552376 GAGAAGCCCCGGCCGCGCGGCGG + Exonic
1152926482 17:83090063-83090085 CACGCGCCCAGGCCCCGGGGTGG + Intronic
1154300611 18:13188029-13188051 GTGGGGCCGAGACCCCGAGGTGG + Intergenic
1154305755 18:13229659-13229681 GAGGCCCCCAGGCCCAGAGGTGG + Intronic
1155067236 18:22278524-22278546 GCTGAGCCCAGGCCCAGTGGTGG + Intergenic
1156401235 18:36742264-36742286 GAGCAGCCCAGGCTGCCAGGTGG + Intronic
1157619458 18:49007939-49007961 CAGGATCCCAGGCCCCAAGCTGG + Intergenic
1157879379 18:51305333-51305355 CAGGAGCCCAGGCCTGGAGTTGG - Intergenic
1158379371 18:56912212-56912234 GAGGTGGTCAGGCCCAGAGGAGG + Intronic
1159040282 18:63318406-63318428 GCTGAGCGCAGGCCCCGCGGCGG + Exonic
1159927366 18:74281396-74281418 GAAAAGCCCAGGCCCCAGGGGGG + Intronic
1160590518 18:79942031-79942053 GAGGAGCTCAGGTCCAGAGAAGG + Intronic
1160689294 19:453786-453808 GTGGAGCCCAGGCCCGGTGGGGG - Intronic
1160719688 19:591729-591751 GGGGCGCCCAGGCCTGGAGGAGG - Intronic
1160894009 19:1394496-1394518 GAGGAGCACGGTCCCCAAGGAGG - Intronic
1160931154 19:1569960-1569982 GAGAAGTCCAGGACCCCAGGAGG - Intergenic
1161289176 19:3483592-3483614 CAGGTGCGGAGGCCCCGAGGTGG - Intergenic
1161389292 19:4012842-4012864 ATGGAGGCCAGGCCCCGATGTGG - Intronic
1161478480 19:4498977-4498999 CGGGAGCCCAGGCCCCCAGCAGG + Intronic
1161659292 19:5536263-5536285 CAGGAGCAGAGGCTCCGAGGTGG + Intergenic
1161776291 19:6263970-6263992 GAGAAGCTCAGGCCCCGCAGTGG - Intronic
1162413001 19:10517646-10517668 GGACAGCCCAGGCCCGGAGGGGG - Intronic
1162908512 19:13837094-13837116 GAGGAGACCGGGCCACGGGGGGG - Intergenic
1164678082 19:30115759-30115781 GAGGAGCCCTGCCCCGGATGGGG - Intergenic
1164992198 19:32692438-32692460 CAGGAGGCCAGGCCCGGCGGTGG - Exonic
1165142274 19:33706896-33706918 GAGGACCACAGGCCGGGAGGAGG + Intronic
1165770034 19:38374686-38374708 GTGGAGCCCAAGGCCCGGGGCGG - Exonic
1165830536 19:38728268-38728290 GAGGAGGCCGGGCCCAGAGTAGG - Intronic
1165855818 19:38878852-38878874 GGGTAGCCCTGGCCCCGTGGGGG + Exonic
1166678057 19:44751247-44751269 GGGGAGCCCATGGCCCGAGTGGG - Exonic
1166702667 19:44891281-44891303 GCGGAGCCCAGGCCGGGAGCAGG + Exonic
1166737203 19:45093229-45093251 GCGGAGCCCATGCCCCGGGACGG + Exonic
1166798663 19:45443187-45443209 AAGGAGGCCAGGCTCCAAGGAGG + Intronic
1167311666 19:48740674-48740696 GAGGAGACCAGGCCTGGGGGAGG + Exonic
1167409203 19:49335162-49335184 GAGGTCCCCATGCCCAGAGGTGG + Intronic
1167411527 19:49347002-49347024 GAGGAGGCCAGCCCCCAGGGTGG - Intronic
1167612664 19:50514880-50514902 GAGGGGCCAAGACCCCGACGTGG + Intergenic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
1202698976 1_KI270712v1_random:148505-148527 GTGAAGCCCAAGCCCCTAGGTGG - Intergenic
925268371 2:2583376-2583398 GAGGGGCACAGGCCCAGAGGTGG - Intergenic
925885281 2:8390250-8390272 GAGGAGCTCAGGACACGAGCAGG + Intergenic
926138970 2:10357164-10357186 GGAGAGCACAGGCCCTGAGGAGG - Intronic
926429575 2:12772355-12772377 CAGGAGCCAAGGCTCTGAGGTGG + Intergenic
927553543 2:24017842-24017864 GAGGAGGCCAGCCCCAGAGGAGG + Intronic
928540282 2:32278092-32278114 GCTGGGCCCAGACCCCGAGGCGG - Exonic
932435638 2:71701216-71701238 GCAGGCCCCAGGCCCCGAGGAGG - Intergenic
932479834 2:72032559-72032581 GAGAGGCCCAGGCCCCTGGGTGG - Intergenic
934169926 2:89531986-89532008 GTGAAGCCCAAGCCCCTAGGTGG - Intergenic
934280228 2:91606294-91606316 GTGAAGCCCAAGCCCCTAGGTGG - Intergenic
934933996 2:98451474-98451496 GAGGATCCCAGGACCGGAGCTGG - Intronic
936433089 2:112481600-112481622 GCGGAGCCCAGGGCTCCAGGGGG + Intergenic
936950617 2:117974218-117974240 GGGGTGCCCAGGGTCCGAGGAGG - Intronic
938367195 2:130744407-130744429 AGGGAGCCCAGGCCCAGACGCGG + Intergenic
938487381 2:131724297-131724319 GCGGAGCCCAGGCCGGGAGCAGG - Intronic
942453896 2:176124737-176124759 GAGGAGCCCAGGGCCTCGGGCGG + Exonic
944207191 2:197169167-197169189 CAGGAGCAAAGGCCCCAAGGAGG - Intronic
945029348 2:205649147-205649169 GAGGACTCCAGCCCCAGAGGTGG + Intergenic
946146584 2:217735582-217735604 CAGGAGCAAAGGCCCTGAGGTGG - Intronic
946245378 2:218384271-218384293 GAGGAAGCCAGGCCCCGTGAAGG - Exonic
947641429 2:231709632-231709654 GGGGCGCCCGGGCCCCGTGGCGG + Intronic
947739505 2:232478703-232478725 GAGGACCCCAGGCCCCATGGAGG - Intergenic
948508312 2:238446200-238446222 GAGGAGAGCAGGCCCCAGGGAGG - Intronic
948550094 2:238765442-238765464 GAAGAGCCCAGGTCACGAGCAGG - Intergenic
948803090 2:240441649-240441671 GAGGAGCCCAGGCTCCGGGCAGG - Intronic
948920228 2:241062909-241062931 GAGGGGCCCTGGCCCCGCTGGGG + Intronic
948934054 2:241150719-241150741 GGGGAGCCCCGGCCCGGGGGCGG + Intronic
949060518 2:241953844-241953866 GAGGTGCCCAGGCCGGGGGGAGG + Intergenic
1169193827 20:3673075-3673097 GAGCAGCCCGGGACCCAAGGTGG + Intronic
1169200993 20:3710190-3710212 GCTGAGCCCAGCCCCTGAGGCGG - Intergenic
1171249478 20:23637513-23637535 GAGAAGCCCAGGCGCCGGAGAGG + Intronic
1172781845 20:37441364-37441386 GAGTAACCCAGGGCCCCAGGAGG - Intergenic
1172853679 20:37984635-37984657 GGGGAGCCCAGCCTCCGAGCAGG - Intronic
1173166901 20:40691943-40691965 GGGGAGGCCAGGCCACGAAGTGG - Intergenic
1173320530 20:41983452-41983474 GGGGAGCCCAGGGCCCAGGGAGG + Intergenic
1174401918 20:50280539-50280561 GAGGGTCCAAGGCCCCCAGGAGG + Intergenic
1174405705 20:50301811-50301833 GAGGAACCCAGGCCCAGTGGAGG + Intergenic
1174916645 20:54660648-54660670 GAGGGGCCACGGCCCCGAAGCGG + Intergenic
1175148126 20:56912032-56912054 GAAAAGCCAAGGCCCGGAGGAGG - Intergenic
1175283967 20:57824925-57824947 GGGGAGCCCAGGGACTGAGGAGG - Intergenic
1175404094 20:58715987-58716009 CAGGAGCCCAGGACCTGGGGAGG + Intronic
1175843862 20:62048694-62048716 ATGGAGCCCAGGGACCGAGGTGG - Intronic
1176083393 20:63285067-63285089 GAGGAGCCCAGGCCCCGAGGAGG - Intronic
1176087805 20:63305966-63305988 GGGGAGCCCAGACCCTGAGCAGG + Exonic
1176131027 20:63496920-63496942 GCGGAGGCCAGGGCCCAAGGTGG - Intronic
1176372796 21:6072613-6072635 GAGGACCACAGGCCCCAGGGAGG - Intergenic
1176524987 21:7859360-7859382 GGGGAGACCAGGCCCCTAAGAGG + Intergenic
1178339925 21:31777669-31777691 CAGGAGCCAAGGTCCCCAGGAGG - Intergenic
1178659007 21:34489373-34489395 GGGGAGACCAGGCCCCTAAGAGG + Intergenic
1179264334 21:39789414-39789436 AAGGTGCCCAAGCCCTGAGGTGG - Intronic
1179750681 21:43465630-43465652 GAGGACCACAGGCCCCAGGGAGG + Intergenic
1179791760 21:43759901-43759923 AAGGACCCCAGGCCCTGGGGAGG + Exonic
1180961951 22:19766203-19766225 GAGGGGCGCGGGCCCCGGGGAGG + Intronic
1181390408 22:22576501-22576523 GAGGAGCCCAAGCCCCAGGGAGG - Intergenic
1181833631 22:25583567-25583589 AAGGAGCCCATGTCCAGAGGGGG - Intronic
1181971723 22:26695669-26695691 CAGGAGCAAAGGCCCTGAGGTGG + Intergenic
1183122387 22:35740035-35740057 GAGGAGCCCAGGGATGGAGGGGG - Intronic
1183379468 22:37483831-37483853 GGGGAGTCCAGGTCCAGAGGGGG + Intronic
1183543718 22:38444502-38444524 GAGAAGCCCATGCTCCGTGGAGG - Intronic
1183547106 22:38460214-38460236 GAGGAGACCAGGCAGGGAGGGGG + Intergenic
1183730275 22:39614638-39614660 GAGGATCCCATGCCCCCAGCTGG - Intronic
1184107669 22:42377747-42377769 TAGGAGCCCAGACTCAGAGGTGG + Intergenic
1184300329 22:43555142-43555164 GAGGAGCCCAGAGCAAGAGGTGG - Intronic
1184923781 22:47623741-47623763 GAGAAGCCCAGGCTCCCAGAGGG + Intergenic
1185070363 22:48652650-48652672 GAGGGGCCCAGACCCCCACGTGG + Intronic
1185119476 22:48957491-48957513 GAGGCGGCCAGGCACCGTGGGGG - Intergenic
1185269636 22:49923097-49923119 GAGGAGGGCAGCCCCTGAGGAGG - Intronic
949919644 3:8990753-8990775 CTGGGGCCCAGGCCCCGGGGCGG + Exonic
950184433 3:10936533-10936555 CTGGAGCCCAGGCCCCTCGGTGG - Intronic
950675415 3:14551424-14551446 GTGGAGCCCAGGGCCTGGGGAGG - Intergenic
950787828 3:15450584-15450606 GAGGAGCTCAGGCACACAGGAGG + Exonic
953283713 3:41583659-41583681 GAGGAGGCCATGGCCTGAGGAGG - Intronic
953718434 3:45335339-45335361 CAGGAGCAAAGGCCCTGAGGTGG + Intergenic
954300688 3:49699374-49699396 CTAGAGCCCAGGCCCCGGGGTGG + Intronic
954337849 3:49930012-49930034 GAGGCGCCCAGGCCCCTAGAAGG - Exonic
955996903 3:64687576-64687598 GGGGAGCCCAGACGCCGCGGCGG - Exonic
960616542 3:119600814-119600836 GGGGAGCCCAGGGCTCAAGGGGG + Intronic
960936441 3:122906848-122906870 GGGGACACCAGGCCCAGAGGTGG - Intergenic
961788081 3:129359389-129359411 GAAGAGCCCAGACCCTGAGTTGG + Intergenic
961812129 3:129527994-129528016 GAGGAGCTCAGGGGCTGAGGAGG - Intergenic
967035372 3:185645352-185645374 GAGAACCCCAGGGGCCGAGGAGG - Exonic
967145909 3:186605794-186605816 GAGGAGCACAGTCCCTGAGGTGG - Intergenic
968501580 4:952603-952625 CAGGACCCCAGGCCCCAAGAGGG - Intronic
968643530 4:1727172-1727194 GAGGAGCCCAGTCTACCAGGTGG + Intronic
968932289 4:3587454-3587476 GAGGAGGCCTGGGCCCAAGGTGG + Intronic
968956462 4:3722216-3722238 CAGGAGCTCAGGTCCAGAGGTGG + Intergenic
969030537 4:4209561-4209583 GTGAAGCCCAAGCCCCTAGGTGG + Intronic
969629709 4:8329146-8329168 GTGGGGTCCAGGCCCAGAGGAGG - Intergenic
980158235 4:129132294-129132316 GAGGATCCCTGGGCCCCAGGAGG - Intergenic
985605576 5:855965-855987 GAGGGGCACAGACCCCGCGGAGG + Intronic
985749985 5:1668150-1668172 AGGGAACCCAGGCCCCAAGGGGG - Intergenic
993901350 5:93585678-93585700 GATGAGCGCAGGCCGGGAGGGGG - Intronic
997201080 5:132010731-132010753 GAGGACCCCAGGCTCAGAGAGGG + Intronic
997445296 5:133935781-133935803 GAGGAGCCCAGAACCAGGGGAGG - Intergenic
997879085 5:137573835-137573857 GAGGAGCCCAGGTGCCTAGAAGG - Intronic
998113610 5:139520389-139520411 AAGGTGTCCAAGCCCCGAGGAGG + Intergenic
998145489 5:139725371-139725393 GATGAGCCCAGTCCCCGGTGAGG - Intergenic
999384999 5:151147826-151147848 GAGGATCCCAGGCCCAGAGAAGG + Intronic
1001434622 5:171689427-171689449 GCAGAGCCCAGGCCCCTAGGAGG + Intergenic
1001601847 5:172934193-172934215 GAGGAGCCCAGGCCACTCCGGGG - Intronic
1001749345 5:174117054-174117076 GAGGATCCCGGGCCTCGAGTCGG + Intronic
1002103463 5:176868684-176868706 CAGGAGCCCAGGTCCAGACGTGG - Intronic
1002199847 5:177521556-177521578 GAGGAGCCCAGGGCAGGAAGTGG + Intronic
1002254615 5:177949915-177949937 GAGGAGCCGAGGCCCACTGGGGG + Intergenic
1002483377 5:179517897-179517919 GAGGAGCCGAGGCCCACTGGGGG - Intergenic
1002643263 5:180640545-180640567 ATGGAGGCCAGGCCCCAAGGAGG - Intronic
1005838106 6:29723206-29723228 CAAGGGCTCAGGCCCCGAGGCGG + Intronic
1005989713 6:30895457-30895479 GGGGGGCCCGGGCCTCGAGGGGG - Exonic
1006189451 6:32198666-32198688 GATGTGCTCAGGCCCTGAGGAGG - Exonic
1006510056 6:34516684-34516706 GAGGGGCCCGGGCCTAGAGGAGG - Intronic
1006787514 6:36678589-36678611 CAGGAGCCTGGGCCCCGGGGAGG + Intronic
1007710994 6:43824209-43824231 GGGGAGCCCAGGCCTCCTGGAGG - Intergenic
1013428482 6:110035511-110035533 TAGGAGCCAAGGCCCCGGGCAGG - Intergenic
1015690855 6:135921052-135921074 GGGGTGGTCAGGCCCCGAGGAGG + Intronic
1016845954 6:148568920-148568942 GTGGAGCCCTGGCACGGAGGAGG + Intergenic
1018900520 6:168049708-168049730 AAGGAGCCCAGGCCCCGAGGAGG + Intergenic
1019187748 6:170230735-170230757 GAGGAGCCCAGGACCTGCGTGGG + Intergenic
1019417961 7:935800-935822 CAGGAGCCCATGCCCCGGGCTGG + Intronic
1019551385 7:1604373-1604395 GCAGAGCCGAGGCCCTGAGGTGG + Intergenic
1019843716 7:3475394-3475416 GAGGAGCCCCACACCCGAGGGGG - Intronic
1020040357 7:4996696-4996718 GAGGAGCCCAGGCCCAGGAGGGG - Intronic
1020094613 7:5361523-5361545 GAGGAGCCCGGGCCCCACGCAGG - Intronic
1020107318 7:5428138-5428160 GAAGAGGCCAGGGCCGGAGGCGG - Intergenic
1021717278 7:23471193-23471215 GCGGTGCCCAGGGCCCGAGAAGG - Intergenic
1025829802 7:65038749-65038771 CATGAGCCCAGGCCGCGGGGCGG + Intergenic
1027200869 7:76063177-76063199 GAGGATGCCAGGCCCGGGGGGGG + Intronic
1029547327 7:101217248-101217270 CCGGGGTCCAGGCCCCGAGGAGG + Exonic
1029689319 7:102170553-102170575 GGGTAGCCCCGGCCCCGTGGGGG + Intronic
1029983008 7:104896613-104896635 AAGGAGCAAAGGCCCAGAGGTGG + Intronic
1033757022 7:144403939-144403961 CAGGAGCCCAGGCCCAGGTGCGG + Intronic
1034671506 7:152862294-152862316 GAGGCCGCCAGGCCACGAGGTGG + Intergenic
1034956301 7:155337531-155337553 GTGGCTCCCAGGGCCCGAGGGGG + Intergenic
1035621318 8:1037365-1037387 GGGAAGCCCTGGGCCCGAGGCGG - Intergenic
1035644756 8:1210473-1210495 GAGGGGCTCAAGCCCTGAGGCGG + Intergenic
1036148252 8:6274826-6274848 GTGAAGCCCACGCCCCTAGGAGG - Intergenic
1037903726 8:22703329-22703351 GGGGAGCCCAGGCCATGAGTAGG + Intergenic
1037946092 8:22990563-22990585 CAGCAGCCCAGGCTCCCAGGGGG + Intronic
1039382594 8:37099962-37099984 GAGGAGCTAAGGGCCCTAGGAGG - Intergenic
1040110981 8:43567122-43567144 GAGGAGGCCAGGCCTTCAGGGGG - Intergenic
1040676531 8:49757317-49757339 GAGAGGCCCAGGGCCAGAGGTGG - Intergenic
1041257590 8:55992498-55992520 AAGGAGCCCAGGCAGGGAGGAGG - Intronic
1041381608 8:57258875-57258897 GAGGACCGCAGGGCCAGAGGAGG + Intergenic
1045337804 8:101224195-101224217 GCGGGGCCCAGGCCACGCGGGGG - Intergenic
1045497542 8:102721002-102721024 GGGGAGCCCAGACCCCAAGCAGG + Intergenic
1047138288 8:122106681-122106703 AAGGAGCCCAGGCCTGGAGTTGG + Intergenic
1048330945 8:133470574-133470596 AAGGAGCTCAGGCCACCAGGCGG - Intronic
1048540121 8:135334699-135334721 GAGAAGCCCAGGACCAGAGCGGG + Intergenic
1048694697 8:137012893-137012915 GAGGTGCCCAGGGCCATAGGAGG - Intergenic
1048832677 8:138491936-138491958 GAGGAGACCAGGTCACAAGGTGG + Intronic
1049095876 8:140547791-140547813 GAGGGTCCCTGGTCCCGAGGGGG + Intronic
1049215117 8:141404303-141404325 GAGGCGCAGAGGCCCCGAAGAGG - Intronic
1049274782 8:141714722-141714744 CAGAAGCCCAGGCCCAGAGAGGG - Intergenic
1049651241 8:143771018-143771040 GCGGAGCCCAGGGCCCCAGAGGG - Intergenic
1049658358 8:143808758-143808780 GAGGAGCCCAGGGTGCGTGGGGG + Exonic
1051410579 9:16785916-16785938 TAGGTGCACAGGCCCAGAGGTGG - Intronic
1053055687 9:34991891-34991913 GAGGCGCCCAAGGCCCTAGGTGG - Intronic
1053299908 9:36941641-36941663 GGGGAGCCCAGGCAAAGAGGGGG - Intronic
1054457842 9:65444474-65444496 GAGGAGGCCTGGGCCCAAGGTGG - Intergenic
1055335729 9:75231485-75231507 CAGGTGCCAAGGCCCCAAGGAGG + Intergenic
1057302893 9:93896707-93896729 GAGGAGCCATGGCCCGGAGTTGG - Intergenic
1060548812 9:124475731-124475753 GAGGCCCCCAGGCCCCTGGGAGG + Intronic
1060552137 9:124490749-124490771 AAGGGGTCCAGGCCCCCAGGAGG + Intronic
1060724771 9:125999495-125999517 GAGGAGCCTGGGCCCCGTGGGGG - Intergenic
1060829505 9:126704787-126704809 GTGGAGCACAGGCTCAGAGGTGG + Intergenic
1061140366 9:128762695-128762717 GGGGAGCACAGGCCCGGAGCTGG - Intronic
1061580223 9:131531569-131531591 GAGGGGGCCAGGCCCGGGGGCGG - Intergenic
1061671892 9:132193477-132193499 AAGGAGCACAGGCTCTGAGGTGG + Intronic
1062024890 9:134335763-134335785 TGGGAGCCAGGGCCCCGAGGTGG - Intronic
1062187451 9:135225471-135225493 GAGGGGCCCAAGCCTCGTGGGGG - Intergenic
1062367186 9:136216497-136216519 GCGGAGCCCGGGCCCCGAGCAGG + Intronic
1062444608 9:136588368-136588390 GAGGAGCCCAGGCCGGAAAGGGG + Intergenic
1062566287 9:137165372-137165394 CAGGAGCCCAGGGTCCGGGGCGG - Intronic
1062577501 9:137215470-137215492 GAGGAGCAGAGGCCCCGGCGGGG - Exonic
1062581432 9:137230797-137230819 CAGGAGCCCAGGCCCTCACGGGG - Exonic
1062596946 9:137303789-137303811 GTGGAGCCCAGGCCCGGGGCAGG + Intergenic
1062615349 9:137393639-137393661 GAGGGGTCCAAGGCCCGAGGAGG + Intronic
1185761357 X:2691568-2691590 CGGGGGCCCAGGCCCGGAGGAGG + Intronic
1185836134 X:3346906-3346928 GAGAAGTCCAGGACCCCAGGAGG + Intergenic
1187510595 X:19914217-19914239 GAGGTGACCAGGCCACGTGGAGG - Exonic
1192203694 X:69082649-69082671 GAGGATCCCAGGCCCTGACTTGG - Intergenic
1192313491 X:70034821-70034843 GGGGAGTCCAGGCCCAGGGGAGG + Intronic
1192556305 X:72092339-72092361 GAGGAGCACAGGCAGTGAGGTGG - Intergenic
1195247464 X:103007479-103007501 GAGGTGGCCAGGCCCAGTGGTGG - Intergenic
1195370333 X:104166738-104166760 GAGCAGCCCAGGGCCAGAGAGGG + Exonic