ID: 1176084835

View in Genome Browser
Species Human (GRCh38)
Location 20:63291144-63291166
Sequence CAGACCACGTGGCAGTGATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176084835_1176084844 15 Left 1176084835 20:63291144-63291166 CCGGATCACTGCCACGTGGTCTG No data
Right 1176084844 20:63291182-63291204 GTGTCAGGAGTCCAGGAGCAGGG No data
1176084835_1176084847 20 Left 1176084835 20:63291144-63291166 CCGGATCACTGCCACGTGGTCTG No data
Right 1176084847 20:63291187-63291209 AGGAGTCCAGGAGCAGGGGCGGG No data
1176084835_1176084850 29 Left 1176084835 20:63291144-63291166 CCGGATCACTGCCACGTGGTCTG No data
Right 1176084850 20:63291196-63291218 GGAGCAGGGGCGGGGTGAACAGG No data
1176084835_1176084846 19 Left 1176084835 20:63291144-63291166 CCGGATCACTGCCACGTGGTCTG No data
Right 1176084846 20:63291186-63291208 CAGGAGTCCAGGAGCAGGGGCGG No data
1176084835_1176084842 8 Left 1176084835 20:63291144-63291166 CCGGATCACTGCCACGTGGTCTG No data
Right 1176084842 20:63291175-63291197 TGCAGAGGTGTCAGGAGTCCAGG No data
1176084835_1176084841 0 Left 1176084835 20:63291144-63291166 CCGGATCACTGCCACGTGGTCTG No data
Right 1176084841 20:63291167-63291189 AGGGGTGCTGCAGAGGTGTCAGG No data
1176084835_1176084848 21 Left 1176084835 20:63291144-63291166 CCGGATCACTGCCACGTGGTCTG No data
Right 1176084848 20:63291188-63291210 GGAGTCCAGGAGCAGGGGCGGGG No data
1176084835_1176084840 -7 Left 1176084835 20:63291144-63291166 CCGGATCACTGCCACGTGGTCTG No data
Right 1176084840 20:63291160-63291182 TGGTCTGAGGGGTGCTGCAGAGG No data
1176084835_1176084845 16 Left 1176084835 20:63291144-63291166 CCGGATCACTGCCACGTGGTCTG No data
Right 1176084845 20:63291183-63291205 TGTCAGGAGTCCAGGAGCAGGGG No data
1176084835_1176084843 14 Left 1176084835 20:63291144-63291166 CCGGATCACTGCCACGTGGTCTG No data
Right 1176084843 20:63291181-63291203 GGTGTCAGGAGTCCAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176084835 Original CRISPR CAGACCACGTGGCAGTGATC CGG (reversed) Intergenic
No off target data available for this crispr