ID: 1176084841

View in Genome Browser
Species Human (GRCh38)
Location 20:63291167-63291189
Sequence AGGGGTGCTGCAGAGGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176084826_1176084841 28 Left 1176084826 20:63291116-63291138 CCCCGGCAGCTCGCCGGCCCTGC No data
Right 1176084841 20:63291167-63291189 AGGGGTGCTGCAGAGGTGTCAGG No data
1176084832_1176084841 10 Left 1176084832 20:63291134-63291156 CCTGCCTGAGCCGGATCACTGCC No data
Right 1176084841 20:63291167-63291189 AGGGGTGCTGCAGAGGTGTCAGG No data
1176084828_1176084841 26 Left 1176084828 20:63291118-63291140 CCGGCAGCTCGCCGGCCCTGCCT No data
Right 1176084841 20:63291167-63291189 AGGGGTGCTGCAGAGGTGTCAGG No data
1176084835_1176084841 0 Left 1176084835 20:63291144-63291166 CCGGATCACTGCCACGTGGTCTG No data
Right 1176084841 20:63291167-63291189 AGGGGTGCTGCAGAGGTGTCAGG No data
1176084833_1176084841 6 Left 1176084833 20:63291138-63291160 CCTGAGCCGGATCACTGCCACGT No data
Right 1176084841 20:63291167-63291189 AGGGGTGCTGCAGAGGTGTCAGG No data
1176084827_1176084841 27 Left 1176084827 20:63291117-63291139 CCCGGCAGCTCGCCGGCCCTGCC No data
Right 1176084841 20:63291167-63291189 AGGGGTGCTGCAGAGGTGTCAGG No data
1176084831_1176084841 11 Left 1176084831 20:63291133-63291155 CCCTGCCTGAGCCGGATCACTGC No data
Right 1176084841 20:63291167-63291189 AGGGGTGCTGCAGAGGTGTCAGG No data
1176084830_1176084841 15 Left 1176084830 20:63291129-63291151 CCGGCCCTGCCTGAGCCGGATCA No data
Right 1176084841 20:63291167-63291189 AGGGGTGCTGCAGAGGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176084841 Original CRISPR AGGGGTGCTGCAGAGGTGTC AGG Intergenic
No off target data available for this crispr