ID: 1176084845

View in Genome Browser
Species Human (GRCh38)
Location 20:63291183-63291205
Sequence TGTCAGGAGTCCAGGAGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176084833_1176084845 22 Left 1176084833 20:63291138-63291160 CCTGAGCCGGATCACTGCCACGT No data
Right 1176084845 20:63291183-63291205 TGTCAGGAGTCCAGGAGCAGGGG No data
1176084839_1176084845 5 Left 1176084839 20:63291155-63291177 CCACGTGGTCTGAGGGGTGCTGC No data
Right 1176084845 20:63291183-63291205 TGTCAGGAGTCCAGGAGCAGGGG No data
1176084835_1176084845 16 Left 1176084835 20:63291144-63291166 CCGGATCACTGCCACGTGGTCTG No data
Right 1176084845 20:63291183-63291205 TGTCAGGAGTCCAGGAGCAGGGG No data
1176084831_1176084845 27 Left 1176084831 20:63291133-63291155 CCCTGCCTGAGCCGGATCACTGC No data
Right 1176084845 20:63291183-63291205 TGTCAGGAGTCCAGGAGCAGGGG No data
1176084832_1176084845 26 Left 1176084832 20:63291134-63291156 CCTGCCTGAGCCGGATCACTGCC No data
Right 1176084845 20:63291183-63291205 TGTCAGGAGTCCAGGAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176084845 Original CRISPR TGTCAGGAGTCCAGGAGCAG GGG Intergenic
No off target data available for this crispr