ID: 1176084850

View in Genome Browser
Species Human (GRCh38)
Location 20:63291196-63291218
Sequence GGAGCAGGGGCGGGGTGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176084835_1176084850 29 Left 1176084835 20:63291144-63291166 CCGGATCACTGCCACGTGGTCTG No data
Right 1176084850 20:63291196-63291218 GGAGCAGGGGCGGGGTGAACAGG No data
1176084839_1176084850 18 Left 1176084839 20:63291155-63291177 CCACGTGGTCTGAGGGGTGCTGC No data
Right 1176084850 20:63291196-63291218 GGAGCAGGGGCGGGGTGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176084850 Original CRISPR GGAGCAGGGGCGGGGTGAAC AGG Intergenic
No off target data available for this crispr