ID: 1176085297

View in Genome Browser
Species Human (GRCh38)
Location 20:63293076-63293098
Sequence CGGCAGACAGGAAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 934
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 867}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176085284_1176085297 2 Left 1176085284 20:63293051-63293073 CCCGTTCTTGGAGAGATGCCCGG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1176085297 20:63293076-63293098 CGGCAGACAGGAAGGGTGGAGGG 0: 1
1: 0
2: 5
3: 61
4: 867
1176085280_1176085297 27 Left 1176085280 20:63293026-63293048 CCTTCGTGCTGGGATCTTTGTGG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1176085297 20:63293076-63293098 CGGCAGACAGGAAGGGTGGAGGG 0: 1
1: 0
2: 5
3: 61
4: 867
1176085283_1176085297 3 Left 1176085283 20:63293050-63293072 CCCCGTTCTTGGAGAGATGCCCG 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1176085297 20:63293076-63293098 CGGCAGACAGGAAGGGTGGAGGG 0: 1
1: 0
2: 5
3: 61
4: 867
1176085286_1176085297 1 Left 1176085286 20:63293052-63293074 CCGTTCTTGGAGAGATGCCCGGG 0: 1
1: 0
2: 0
3: 20
4: 702
Right 1176085297 20:63293076-63293098 CGGCAGACAGGAAGGGTGGAGGG 0: 1
1: 0
2: 5
3: 61
4: 867

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176085297 Original CRISPR CGGCAGACAGGAAGGGTGGA GGG Intergenic
900298979 1:1967337-1967359 CGACAGACAGGAAGTCTGGACGG + Intronic
900308715 1:2023370-2023392 TGCCAGACAGGCAGTGTGGAGGG + Intronic
900368910 1:2322849-2322871 CGGCGGATGGGAAGGGTGGGCGG + Intronic
900592264 1:3465377-3465399 AGGCAGACAGGAGGAGAGGACGG + Intronic
900863071 1:5246461-5246483 AGGGAGAGAGGAAGGGAGGAGGG - Intergenic
900863131 1:5246675-5246697 AGGAAGACAGGAAGGAGGGAGGG - Intergenic
901180805 1:7340581-7340603 TGGAAGCCAGGAAGGATGGAAGG - Intronic
901456881 1:9368141-9368163 CGGCAGCCAGGATGGGTGCTGGG - Exonic
901899284 1:12344722-12344744 AGGCTGACAGGAAGCGGGGAGGG - Intronic
902155041 1:14478276-14478298 AGGAAGGAAGGAAGGGTGGATGG + Intergenic
902326509 1:15704313-15704335 AGGAAGAAAGGAAGGGAGGAAGG - Intronic
902688907 1:18097356-18097378 AGGAAGAAAGGAAGGGAGGAAGG - Intergenic
902692014 1:18115812-18115834 AGGAAGACAGGAAGGAAGGAAGG + Intronic
902700281 1:18167656-18167678 CAGCAGAAGGAAAGGGTGGACGG - Intronic
902912803 1:19613088-19613110 TGGAATACAGGAAAGGTGGAGGG + Intronic
903033930 1:20482298-20482320 CTGCAGACAGGAAGGAGGGATGG - Intergenic
903362207 1:22783777-22783799 CCCCAGGCAGGAAGGGTGGGCGG + Intronic
903662858 1:24989321-24989343 CAGCAGAGGGGAAGGGTGGGAGG + Intergenic
904505820 1:30952712-30952734 AGGAAGAGAGGAGGGGTGGAGGG + Intronic
904918103 1:33984877-33984899 AGGCAGGCAGGAAGGAAGGAAGG + Intronic
905029847 1:34874808-34874830 CAGCAGGCAGGAAGGGTGGGAGG + Intronic
905300373 1:36982697-36982719 GGTCAGGAAGGAAGGGTGGAAGG + Intronic
905891672 1:41522053-41522075 AGACAGACAGGAAGGCAGGAGGG + Intronic
906489247 1:46255106-46255128 CAGAAGACAGGAAGAGTGGGAGG + Intronic
907394842 1:54181943-54181965 GGGAAGACAGGAAGGCAGGAAGG + Intronic
907408069 1:54265864-54265886 GGGCAGACAGCAAGGGTTCAGGG + Intronic
907437522 1:54459057-54459079 GGGCAGGCAGGAAGGAGGGAGGG + Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907560470 1:55382893-55382915 CTGCTGACAGGAAGGCTGGGAGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907832974 1:58082796-58082818 CAGCAGACAGGTGGGGGGGAGGG + Intronic
908401340 1:63774768-63774790 GCGCTGACAGGAAGCGTGGAGGG + Intronic
908462306 1:64357380-64357402 AGGAAGAGAGGAAGGGAGGAAGG - Intergenic
908680907 1:66660009-66660031 AGACAGACAGGAAGGAAGGAAGG + Intronic
908858797 1:68459874-68459896 AGGAAGAGAGGAAGGGAGGAAGG - Intergenic
908967926 1:69787948-69787970 AGGCAGGCAGGAGGGATGGAGGG - Intronic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910735037 1:90444341-90444363 CGGGAGAAAGGAAGGAAGGAAGG + Intergenic
911022295 1:93400916-93400938 TGACTGACAGGAAGGGTGGGAGG + Intergenic
911644787 1:100326594-100326616 AGGAAGGGAGGAAGGGTGGAAGG - Intergenic
912348442 1:108988215-108988237 GGGGAGATAGGAAGGGGGGAGGG + Intronic
912806299 1:112759438-112759460 CGAGAGACAGGAAGGAAGGAAGG + Intergenic
913208916 1:116567264-116567286 GGGGAGAGAGGAAGGATGGAAGG + Intronic
913324068 1:117611046-117611068 AAGCAGCCAGGAAAGGTGGAGGG - Intronic
914191889 1:145419118-145419140 AGGCAGGGAGGAAGGGAGGAAGG + Intergenic
916423985 1:164663237-164663259 AGGCAGGCAGGAAGGCAGGAAGG - Intronic
917062008 1:171051583-171051605 TGGCAGAGAGGCAGGGAGGAGGG + Intronic
917816216 1:178712783-178712805 AGGAAGGCAGGAAGGGAGGAAGG + Intergenic
918168720 1:181975120-181975142 CTGGAGCCAGGAAGGCTGGACGG + Intergenic
919163310 1:193860091-193860113 AGGAAGGCAGGAAGGGAGGAAGG - Intergenic
919287913 1:195588699-195588721 AGGAAGAAAGGAAGGGAGGAAGG + Intergenic
919613548 1:199776909-199776931 AGGCAGGCAGGCAGGGAGGAAGG - Intergenic
919851222 1:201674290-201674312 CAGCAGAGAGGAAGGGTGGTGGG + Intronic
920281010 1:204843671-204843693 AGGGAGAAAGGAAGGGAGGAAGG - Intronic
920295829 1:204955726-204955748 AGGCAGACAGGTAGGCGGGAAGG - Intronic
920495919 1:206454843-206454865 GGGCAGGCAGGCAGGGAGGAGGG - Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921007515 1:211109275-211109297 GGGCAGCCAGGAAGAGTGGCAGG + Intronic
921852024 1:219941496-219941518 AGGCAGAGAGGAAGGGAGGGAGG - Intronic
921852041 1:219941568-219941590 AGGCAGAGAGGAAGGGAGGGAGG - Intronic
921852063 1:219941665-219941687 AGGGAGAAAGGAAGGGAGGAAGG - Intronic
921891053 1:220353782-220353804 AGGCAGACAGGCAGGTTGTAGGG - Intergenic
922464036 1:225834412-225834434 AGGGAGAAAGGAAGGATGGACGG + Intronic
922775535 1:228212832-228212854 CGGCAGACCGCAAGGGCGAAAGG - Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923740976 1:236654846-236654868 AGGCAGGCAGGAAGGAAGGAAGG - Intergenic
923740982 1:236654870-236654892 AGGCAGGCAGGAAGGCAGGAAGG - Intergenic
924537824 1:244952513-244952535 AGGGAGAGAGGAAGGGAGGAAGG + Intergenic
1062849548 10:733155-733177 AGGGAGAGAGGAAGGGAGGAGGG - Intergenic
1062876986 10:950959-950981 AGGCAGACAGGCAGGCGGGAAGG - Intergenic
1063218099 10:3942239-3942261 AGGCAGAAAGGAAGGGAGGGAGG + Intergenic
1063721521 10:8586899-8586921 AGGCAGGGAGGAAGGGAGGAAGG - Intergenic
1064720644 10:18225588-18225610 CGGAAGAAAGGAAGGAAGGAAGG - Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065371284 10:24989262-24989284 AGGCAGACAGGCAGGAAGGAAGG - Intronic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066562798 10:36689015-36689037 GGGGAGACTGGAAGGCTGGAGGG - Intergenic
1067280602 10:44869344-44869366 AGGAAGACAGGAAGGAAGGAGGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068885036 10:62089450-62089472 AGGCAGGCAGGAAGGAAGGAAGG - Intronic
1068912143 10:62389668-62389690 CAGCAGAGAGGAAGGGAGGAAGG + Intronic
1070068514 10:73062129-73062151 TGACAGAAAGAAAGGGTGGAAGG + Intronic
1070598583 10:77849715-77849737 AGGCAGACAGGAAAGGGAGAGGG + Intronic
1070888612 10:79925818-79925840 AGGGAGAAAGGAAGGGAGGAAGG - Intergenic
1071071291 10:81697211-81697233 CTGGAGCCAGGAAGGCTGGATGG + Intergenic
1071087313 10:81877680-81877702 TGGGAGACAGGAAGGAGGGAAGG + Intronic
1071160493 10:82740188-82740210 AGGAAGAGAGGAAGGGAGGAAGG - Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071453306 10:85820092-85820114 AGGCAGGAAGGAAGGGAGGAAGG + Intronic
1072222341 10:93336978-93337000 AGGCAGGCAGGAAGGGAAGAGGG + Intronic
1072892893 10:99340865-99340887 AGGCAGGCAGGAAGGAAGGAAGG - Intronic
1073473942 10:103740815-103740837 GGGAAGGAAGGAAGGGTGGAAGG - Intronic
1073731373 10:106292122-106292144 AGACAGACAGGAAGGAAGGAAGG + Intergenic
1074154107 10:110783213-110783235 AGGGAGAGAGGAAGGGTGGAGGG + Intronic
1074656544 10:115595211-115595233 AGGAAGAAAGGAAGGGAGGAAGG - Intronic
1075002467 10:118808698-118808720 CAGCAGAGGGGCAGGGTGGAGGG - Intergenic
1075049824 10:119175324-119175346 CAGCAGGCAGGAATGGTTGAAGG + Intronic
1075059771 10:119247894-119247916 CAGCAGCCAGGCAGGGTGGGGGG - Intronic
1075153250 10:119953741-119953763 AGGAAGAGAGGAAGGGAGGAAGG - Intergenic
1075579265 10:123604488-123604510 CGGCAGACAAGCAGTGAGGAAGG - Intergenic
1075663111 10:124212029-124212051 CCACAGACATGGAGGGTGGAGGG - Intergenic
1076124077 10:127961052-127961074 CAGCAGAGAGGAAGGGTGAGTGG - Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076453908 10:130576120-130576142 GTGCAGACAGGCTGGGTGGATGG - Intergenic
1076930627 10:133529407-133529429 GGGCAGGCAGGGAGGGAGGAAGG - Intronic
1077524441 11:3056047-3056069 AGGCACACAGGTAGGGTGGTAGG + Intronic
1077526583 11:3069452-3069474 AGGGAGAGAGGAAGGGAGGAAGG + Intergenic
1077924545 11:6667834-6667856 AGAGAGACAGGAAGGCTGGAGGG + Intergenic
1078899024 11:15624007-15624029 GGACAAGCAGGAAGGGTGGAGGG + Intergenic
1079464230 11:20713584-20713606 GGGCAGACAGGGAGGGGGCAAGG - Intronic
1079723082 11:23844057-23844079 AGGAAGACAGGAAAGATGGAAGG - Intergenic
1079788840 11:24710922-24710944 TGGAAGGCAGGAAGGGAGGAAGG + Intronic
1079826462 11:25201220-25201242 AGGCAGGCAGGAAGGAAGGAAGG + Intergenic
1080421864 11:32117826-32117848 AGGCAGAAAGGAAGGAAGGAAGG + Intergenic
1080641713 11:34162300-34162322 CTCCAGCCAGGCAGGGTGGAGGG + Intronic
1080851719 11:36076252-36076274 AGACAGACAGGATGGATGGATGG - Intronic
1081042010 11:38224756-38224778 CTGAACATAGGAAGGGTGGAAGG - Intergenic
1081264749 11:41005969-41005991 AGGAAGAGAGGAAGGGAGGAAGG - Intronic
1081519342 11:43866513-43866535 GGGCAGCATGGAAGGGTGGAAGG - Intergenic
1081606671 11:44531447-44531469 AGGCAGCCAGGCAGGGTGGGGGG - Intergenic
1083002185 11:59302782-59302804 CAGCAGACACTATGGGTGGAAGG - Intergenic
1083830571 11:65230026-65230048 AGGAAGAAAGGAAGGATGGAAGG - Intergenic
1084420603 11:69058675-69058697 CGGCAGAGCGGAAGGGTGGCTGG + Intronic
1084533359 11:69742518-69742540 CACCAGCCTGGAAGGGTGGAGGG + Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085426657 11:76410765-76410787 CGGCAGGCAGGCAGGGCAGAGGG + Intronic
1085775110 11:79358606-79358628 AGGCAGGCAGGAAGGGAGGAAGG - Intronic
1085970772 11:81587954-81587976 AGGAAGAAAGGAAGGGAGGAGGG + Intergenic
1086261191 11:84943333-84943355 AGGCAGGCAGGAAGGCAGGAAGG - Intronic
1086276304 11:85133736-85133758 CTGCAGACAGCAAGTGAGGAGGG - Intronic
1086277129 11:85144496-85144518 AGGAAGACAGGAAGGAAGGAGGG - Intronic
1086406201 11:86500881-86500903 AAGCAGACAGGAAGGGTGTGTGG - Intronic
1086964128 11:93010022-93010044 CAGCAGGTAGGATGGGTGGAAGG + Intergenic
1087919118 11:103846280-103846302 CGGAAGGAAGGAAGGGAGGAAGG - Intergenic
1088967582 11:114739335-114739357 AGGGAGAGAGGAAGGGGGGAAGG - Intergenic
1089661259 11:119987170-119987192 AGGCAGACAGGCAGGAAGGAAGG + Intergenic
1089883830 11:121800528-121800550 TGGGAGACAGGAAAGGAGGAAGG + Intergenic
1090089421 11:123681741-123681763 AGGAAGACAGGAAGGCAGGAAGG + Intergenic
1090537821 11:127664121-127664143 TGCGAGACAGGAAGGCTGGAGGG - Intergenic
1090711138 11:129386862-129386884 AGGCAGACAGGAGTGGTGGCAGG - Intronic
1090950423 11:131468166-131468188 AGACAGACAGGAAGGGGGGCAGG - Intronic
1091558614 12:1594251-1594273 CGGCAGGAAGGAAGGACGGACGG - Intronic
1091568404 12:1663730-1663752 AGGAAGAAAGGAAGGATGGAGGG + Intergenic
1091756345 12:3054754-3054776 AGGCAGGCAGGAAGGCAGGAAGG - Intergenic
1091780809 12:3213520-3213542 CAGGAGAGAGCAAGGGTGGAGGG + Intronic
1091806669 12:3361838-3361860 CAGCAGGCAGCAAGGGTGGCAGG - Intergenic
1091916909 12:4276234-4276256 TCGCAGAAAGGAAGGGAGGAAGG - Intronic
1091931518 12:4399408-4399430 GGGAAGACAGGAAGGATGGAGGG + Intergenic
1092735830 12:11581563-11581585 TGGCAGGCAGGAAGGAAGGAAGG + Intergenic
1092966689 12:13650539-13650561 CAGCAGAAAGAAAGGGTGGCTGG - Intronic
1093143819 12:15540832-15540854 GGGCAGACTGGAAGGCTGCAAGG - Intronic
1093161816 12:15755733-15755755 CAGCAGACAGGAAGGGACGAGGG - Intronic
1093182651 12:15984336-15984358 CTGTGGACAGGATGGGTGGAGGG - Intronic
1093215788 12:16359910-16359932 GGGCAGGGAGTAAGGGTGGAAGG - Intronic
1093659431 12:21736941-21736963 AGGAAGAGAGGAAGGGAGGAAGG - Intronic
1094135933 12:27126201-27126223 AGGGAGAGAGGAAGGGAGGATGG - Intergenic
1094185478 12:27637948-27637970 AGGGAGAGAGGAAGGGAGGAAGG - Intronic
1094328174 12:29262711-29262733 AGGAAGACAGGAAGGAAGGAAGG + Intronic
1095581617 12:43806412-43806434 CGGCGGCCAGGAAGGGCGGCGGG - Intergenic
1095654114 12:44649224-44649246 AGGCAGACAAGAAGGAGGGAAGG - Intronic
1095752625 12:45729060-45729082 CGGCAGAGAGGGAGGCTGGCGGG + Intergenic
1095857237 12:46873845-46873867 CGGAAGAAAGGAAGGAAGGAAGG - Intergenic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096140877 12:49241633-49241655 AGGAAGAAAGGAAGGGAGGAAGG - Intronic
1096156049 12:49342167-49342189 CGGCGGACAGGATGGATGGCGGG - Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096576449 12:52555938-52555960 AGGAAGAAAGGAAGGGTGGGAGG - Intergenic
1096609146 12:52789708-52789730 CGACAGACCGGAGGGGCGGAGGG + Exonic
1097075102 12:56387203-56387225 CAGCACACAGCAAGAGTGGAAGG + Intergenic
1097313603 12:58149065-58149087 AGGGAGAGAGGAAGGATGGAAGG - Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1097926493 12:65134070-65134092 AGGAAGAGAGGAAGGGAGGAAGG + Intergenic
1097926505 12:65134126-65134148 AGGAAGAGAGGAAGGGTAGAAGG + Intergenic
1098177309 12:67806129-67806151 GGGAAGAAAGGAAGGGAGGAAGG - Intergenic
1098698752 12:73595311-73595333 AGGAAGAAAGGAAGGGAGGAAGG - Intergenic
1100102806 12:91130140-91130162 AGGCAGGCAGGAAGGAAGGAAGG - Intergenic
1100643324 12:96503392-96503414 AGGGAGAGAGGAAGGGAGGAAGG - Intronic
1100742888 12:97614771-97614793 AGGCAGGCAGGAAGGAAGGAAGG - Intergenic
1100877286 12:98975369-98975391 AGGAAGGTAGGAAGGGTGGAAGG - Intronic
1101036124 12:100708452-100708474 AGGAAGAGAGGAAGGGAGGAAGG - Intergenic
1101504182 12:105330984-105331006 CGGCGGGAAGGAAGGGTGCAGGG + Intronic
1101827487 12:108231887-108231909 GGAGAGACAGGAAGGGAGGAAGG + Intronic
1102012485 12:109627177-109627199 AGGCAGACAGGCAGAGAGGAGGG + Intergenic
1102638710 12:114347234-114347256 AGGCAGGCAGGAAGGAAGGAAGG + Intergenic
1102729815 12:115098657-115098679 AGGCAGTCAGGAAGGCAGGAAGG - Intergenic
1103029748 12:117603477-117603499 GGCCAGACAGGAAGGGCGGTGGG - Intronic
1103030220 12:117606667-117606689 AGGCAGGCAGGGAGGGAGGAAGG - Intronic
1104238799 12:126966622-126966644 AGGCGGCCAGGAAGGGTGCATGG - Intergenic
1104292416 12:127482491-127482513 CGGCAGAGGTGAAGGGTTGATGG - Intergenic
1104540117 12:129656203-129656225 AGGAAGATAGGAAGGGAGGAAGG + Intronic
1104683531 12:130768866-130768888 CAGCAGACGGGAAGGGTGGGAGG - Intergenic
1104901628 12:132192475-132192497 GGGCAGCCAGGCAGGGTTGAAGG + Intergenic
1105247703 13:18667496-18667518 AGGCAGACAGGATGTGGGGAAGG - Intergenic
1105304580 13:19159741-19159763 CTCCAGACTGTAAGGGTGGAGGG - Intergenic
1105309004 13:19189851-19189873 AGGATGACAGGAAGGGAGGAGGG - Intergenic
1106104472 13:26722129-26722151 TGGCAGTCAGGACGGGTGGGTGG + Intergenic
1107221389 13:37985250-37985272 AGGCAGGCAGGAAGGGAAGAAGG + Intergenic
1109181567 13:59220048-59220070 CGGAAGGAAGGAAGGGAGGAAGG + Intergenic
1109370710 13:61416213-61416235 AGGAAGAAAGGAAGGGGGGAAGG - Intronic
1109473994 13:62854009-62854031 AGGCAGGCAGGAAGGAAGGAAGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109759685 13:66811665-66811687 AGGCAGACAGGCAGGCAGGAAGG - Intronic
1109939484 13:69342789-69342811 AGGAAGATAGTAAGGGTGGAAGG - Intergenic
1109997615 13:70149929-70149951 AGGCAGAGAGGAAGTGAGGAAGG + Intergenic
1110916523 13:81028213-81028235 AGGAAGACAGGAAGGAAGGAAGG - Intergenic
1111084136 13:83351810-83351832 AGGGAGAAAGGAAGGGGGGAAGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1112346660 13:98595825-98595847 GGTCAGGCAGGAATGGTGGAGGG + Intergenic
1112355976 13:98675321-98675343 CGGCATACAGGATGTGGGGAGGG - Intergenic
1112404586 13:99107810-99107832 AGGAAGGCAGGAAGGGAGGAGGG + Intergenic
1112661891 13:101519500-101519522 AGGCAGACAGGCAGGAAGGAAGG - Intronic
1113541017 13:111109558-111109580 CAGAGGACAGGAAGGGTGGAGGG + Intergenic
1113787745 13:113011511-113011533 CGGTGGACAGGCTGGGTGGATGG + Intronic
1113787767 13:113011634-113011656 CGGTGGACAGGCAGTGTGGACGG + Intronic
1113787835 13:113011961-113011983 CGGTGGACAGGCTGGGTGGATGG + Intronic
1113787863 13:113012125-113012147 CGGTGGACAGGCAGTGTGGACGG + Intronic
1113787870 13:113012166-113012188 CGGTGGACAGGCAGTGTGGATGG + Intronic
1113787881 13:113012206-113012228 CGGTGGACAGGCTGGGTGGATGG + Intronic
1113787901 13:113012329-113012351 CGGTGGACAGGCAGTGTGGACGG + Intronic
1113787908 13:113012370-113012392 CGGTGGACAGGCAGTGTGGACGG + Intronic
1113787915 13:113012411-113012433 CGGTGGACAGGCAGTGTGGACGG + Intronic
1113787934 13:113012492-113012514 CGGTGGACAGGCTGGGTGGATGG + Intronic
1113787974 13:113012718-113012740 CGGTGGACAGGCAGTGTGGACGG + Intronic
1113849275 13:113408854-113408876 CTGCAGAGAGGAAGGGAGGAGGG + Intergenic
1114825647 14:26074965-26074987 AGGAAGAAAGGAAGGGAGGAAGG + Intergenic
1115157966 14:30361651-30361673 AGGCAAACAGAAAGGGTGCAGGG + Intergenic
1116560934 14:46377435-46377457 CTGAAGCCAGGAAGGCTGGACGG - Intergenic
1116585233 14:46695087-46695109 AGGAAGACAGGAAGGAAGGACGG + Intergenic
1116745721 14:48816137-48816159 CAGAAGCCAGGAAGGGTAGAAGG + Intergenic
1117488649 14:56224853-56224875 AGGCAGACAGGAAGAGGGTATGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119248044 14:73129901-73129923 GGGCAGACAGTAAGTGTGAAAGG + Intergenic
1119387272 14:74265573-74265595 CAGCACAAAGGAAAGGTGGAGGG + Intergenic
1119657793 14:76429955-76429977 AGGCAGGCAGGAAGGAAGGAAGG - Intronic
1119657800 14:76429983-76430005 AGGCAGACAGGAAGGCAGGAAGG - Intronic
1119710650 14:76820429-76820451 CAGCAGACAGGGAGGGACGAGGG + Intronic
1120237466 14:81909088-81909110 CTGCAGAGAGGAAGGGTGGGAGG + Intergenic
1120635283 14:86943745-86943767 AGGCAGAGAGGAAGGGAGAAAGG - Intergenic
1120635312 14:86943859-86943881 AGGCAGAGAGGAAGGAAGGAAGG - Intergenic
1120746907 14:88160366-88160388 CAGAAGAAAGGAAGGGAGGATGG - Intergenic
1120746973 14:88160875-88160897 CAGAAGAAAGGAAGGGTGGATGG - Intergenic
1120920318 14:89749144-89749166 CGGCAGACAGCAAAGGTGATGGG - Intergenic
1120964931 14:90158680-90158702 AGGCAGGCAGGAAGGGAGGAAGG - Intronic
1120974446 14:90236297-90236319 AGGCAGGCAGGAAGGAAGGAAGG - Intergenic
1120982313 14:90300942-90300964 AGGCAGGCAGGCAGGGTGGGAGG + Intronic
1121539254 14:94712730-94712752 AGGCAGGCAGGAAGGAAGGAAGG + Intergenic
1121971362 14:98359420-98359442 AGACAGACAGGAAGGAAGGAAGG - Intergenic
1122506271 14:102233783-102233805 CTGCAGACTGGAAGGGCAGAAGG + Exonic
1122914866 14:104854226-104854248 CGGCAGTCAGGAGCAGTGGAGGG + Intergenic
1124021995 15:25933670-25933692 GGGCAGAAAGGAAGGGAGGGAGG + Intergenic
1125182150 15:36888994-36889016 TGGAAGAGAGGAGGGGTGGACGG + Intergenic
1125701490 15:41689351-41689373 AGGGAGAAAGGAAGGGAGGAAGG - Intronic
1126444125 15:48722778-48722800 AGGCATGCAGGAAGGGGGGAAGG + Intronic
1126477481 15:49080431-49080453 AGGAAGAGAGGAAGGGAGGAAGG - Intergenic
1126541578 15:49830137-49830159 TGGAAGACAGAAAGGGCGGAAGG + Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1127064394 15:55221961-55221983 AGTCAGACAGGAAGGGGAGAAGG - Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1127332273 15:57950828-57950850 AGGGAGAGAGGGAGGGTGGAAGG + Intergenic
1128237164 15:66076195-66076217 TGACAGACAGGATGGATGGATGG + Intronic
1128338899 15:66806176-66806198 AGAGAGACAGGAAGGATGGAGGG - Intergenic
1128459340 15:67854523-67854545 CTGCAGACAGGAAGCTTGCAGGG + Intergenic
1128677810 15:69624651-69624673 AGGCAGGCAGGAAGGGAGGGAGG - Intergenic
1129118974 15:73383520-73383542 TGACAGAGAGGGAGGGTGGAAGG - Intergenic
1129702657 15:77776507-77776529 AGGAAGGCAGGAAGGGAGGAAGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129951965 15:79599830-79599852 CAGAGGACAGGAAGGTTGGAGGG + Intergenic
1130000505 15:80042299-80042321 TGGTAGACAGGAAGGAAGGAGGG - Intergenic
1131072443 15:89474765-89474787 AGGCAGGCAGGAAGGAAGGAAGG - Intronic
1131072448 15:89474785-89474807 AGGCAGGCAGGAAGGAAGGAAGG - Intronic
1131072474 15:89474889-89474911 AGGCAGGCAGGAAGGAAGGAAGG - Intronic
1131072513 15:89475049-89475071 AGGCAGGCAGGAAGGAAGGAAGG - Intronic
1131072518 15:89475069-89475091 AGGCAGGCAGGAAGGCAGGAAGG - Intronic
1131072533 15:89475149-89475171 AGGCAGGCAGGAAGGAAGGAAGG - Intronic
1131588577 15:93722539-93722561 AGGAAGAAAGGAAGGGAGGAAGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131680182 15:94713395-94713417 AGGCAACCAGGAAGGCTGGAGGG + Intergenic
1131841949 15:96446871-96446893 GTGCAGACAGGAAGGGTGAAGGG - Intergenic
1132677563 16:1126953-1126975 AGGCGGACATGAAGGGTGCAGGG + Intergenic
1132723443 16:1327979-1328001 CCAGAGACAGGCAGGGTGGATGG - Intergenic
1132939015 16:2497891-2497913 AGGCAGACAGGCAGGGAGGCAGG - Intronic
1133087454 16:3375924-3375946 AGGGAGAAAGGAAGGGAGGAAGG - Intronic
1133594001 16:7272998-7273020 AGGCAGAAAGGAAGGGAGGAAGG - Intronic
1133605137 16:7379717-7379739 AGGCAGAAAGGAAGGAAGGAAGG - Intronic
1134637010 16:15800213-15800235 AGGAAGAAAGGATGGGTGGATGG + Intronic
1135234289 16:20741442-20741464 CGGGAGGAGGGAAGGGTGGAGGG - Intronic
1135342843 16:21663949-21663971 CGGCAGCTAGGAAGCGAGGATGG - Intergenic
1135795071 16:25433846-25433868 AGGCAGGCAGGAAGGAAGGAAGG - Intergenic
1136067513 16:27768828-27768850 CTGCAGAAAGGAAGGGAGGAAGG - Intronic
1136178509 16:28535038-28535060 GGGCAAACAGGAAGTGTGGTTGG - Intronic
1136290465 16:29268445-29268467 GTGCAGACAGGACGGGAGGAAGG + Intergenic
1136350426 16:29703422-29703444 AGGCAGAAAGGAAGGAAGGAAGG + Intergenic
1136409406 16:30067374-30067396 CAGGAGACAGAATGGGTGGAGGG + Intronic
1136614922 16:31392964-31392986 CGGCAGAGAGGCAGGGAGAAGGG - Intergenic
1137566723 16:49537978-49538000 GGGCAGACAGGAGGGCTGGCTGG - Intronic
1137673653 16:50293222-50293244 GGGCAGGCAGGCAGGGAGGATGG + Intronic
1138103970 16:54277136-54277158 CTAAAGACAGGAAGGGAGGAAGG + Intergenic
1138167400 16:54815892-54815914 AGGAAGAGAGGAAGGGAGGAAGG + Intergenic
1138401983 16:56754025-56754047 GGGCGTACAGGAAGCGTGGATGG + Intronic
1138433928 16:56986546-56986568 TGGCAAATAGGAAGGGTAGAGGG + Intergenic
1139028986 16:62855895-62855917 AGGCAGAAAGGAAGGGAGGAAGG + Intergenic
1139209983 16:65067861-65067883 AGGGAGAAAGGAAGGGAGGAAGG + Intronic
1139422041 16:66854893-66854915 GGGCAGGCAGGAATGGTGGCAGG + Intronic
1140117722 16:72057264-72057286 AGGCAGACAGGAAGGGAGAAAGG - Intronic
1140119957 16:72075017-72075039 AGGCAGACAGGAAGGGAGAAAGG - Intronic
1140771271 16:78205985-78206007 ATGGAGACAGGAAGGGAGGAAGG - Intronic
1141215720 16:82021268-82021290 CAGAAGACAGGAAAGGTAGAGGG + Intergenic
1141240368 16:82260145-82260167 AGGCAGGCAGGAAGGAAGGAAGG - Intergenic
1141774570 16:86114237-86114259 GGGAAAAGAGGAAGGGTGGAGGG + Intergenic
1142018054 16:87762380-87762402 CTGCAGACAGGAAGGCTGGCAGG - Intronic
1142018071 16:87762500-87762522 CAGCAGACAGGAAGGCAGGCAGG - Intronic
1142096349 16:88241966-88241988 GTGCAGACAGGATGGGAGGAAGG + Intergenic
1142523004 17:518268-518290 CGGTGGACAGGAAGGGCGGGGGG + Exonic
1142708153 17:1709457-1709479 AGCCAGACAGGAAGGGAGGAGGG - Intronic
1143014981 17:3886939-3886961 CAGCAGACAGGAAGGATGGAGGG - Intronic
1143404421 17:6667768-6667790 CGTCAGACAGGAAGCCTGGGGGG + Intergenic
1143610295 17:8014102-8014124 CTGCAGACAGGCAGGCTGGCAGG + Intronic
1143698626 17:8640045-8640067 AGGTTGACAGGATGGGTGGATGG + Intergenic
1143927721 17:10387325-10387347 GGGCACAAAGAAAGGGTGGAGGG - Intergenic
1144415144 17:15039235-15039257 AGGAAGACAGGGAGGGTGGAAGG + Intergenic
1144970230 17:19104153-19104175 AGGAAGACAGGAAAGGAGGAAGG - Intergenic
1144990535 17:19230320-19230342 AGGAAGACAGGAAAGGAGGAAGG - Intronic
1145109076 17:20145774-20145796 TGGCAGGCAGGAAGGAAGGAAGG + Intronic
1145392827 17:22469295-22469317 CCGCAGGGAGGAAGGATGGAGGG + Intergenic
1146159205 17:30550837-30550859 TGGCACCCAGGAAGGGTGGGTGG - Intergenic
1146922490 17:36722817-36722839 AGGCAGCCAGGCAGGGTGGAAGG + Intergenic
1147254450 17:39173890-39173912 CACCAGACAGGGAGGGGGGAAGG + Exonic
1147538283 17:41335012-41335034 GGGCACCCAGGAAGGGTGGGTGG + Intergenic
1147648074 17:42045908-42045930 GGGCAGACAGGAATGGCGGGAGG - Intronic
1147731792 17:42608880-42608902 AGGCAGAGAAGATGGGTGGACGG + Intronic
1148004788 17:44418164-44418186 AGGAAGAAAGGAAGGGAGGAAGG + Intronic
1148083038 17:44977860-44977882 CAGCAGGCAGGAGAGGTGGAGGG + Intergenic
1148205132 17:45775232-45775254 GAGCAGACAGGGAGGGTGAAGGG + Intergenic
1148231968 17:45941686-45941708 AGGCAGGCAGGAAGGAAGGAAGG - Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148459203 17:47828525-47828547 TGGCAGGCATGATGGGTGGATGG + Exonic
1148607521 17:48941514-48941536 CAGCCGACAGAAAGGCTGGATGG + Intronic
1148619913 17:49026704-49026726 AGGCAGGCAGGAAGGCAGGAAGG - Intronic
1148619918 17:49026724-49026746 AGGCAGGCAGGAAGGCAGGAAGG - Intronic
1148960898 17:51391959-51391981 AGGCAGTCAGGAAGGGAGGATGG + Intergenic
1148961077 17:51393413-51393435 AGGCAGTCAGGAAGGGAGGATGG + Intergenic
1149197914 17:54145101-54145123 GGGCAGCCAGGAATGGGGGATGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149676930 17:58473038-58473060 AGGCAGACAGGCAGGGGGGCAGG + Intronic
1150122586 17:62616504-62616526 TGGCTGGCAGGAAGGGTGGCAGG - Intergenic
1150583137 17:66493564-66493586 CGGGAGACAGGAAGGGAGGCAGG - Intronic
1150734564 17:67725429-67725451 AAGCAGCCATGAAGGGTGGAGGG - Intronic
1150991396 17:70264040-70264062 AGGAAGGCAGGAAGGGAGGAAGG - Intergenic
1150991399 17:70264048-70264070 CGGCAGGCAGGAAGGCAGGAAGG - Intergenic
1151191280 17:72399838-72399860 CTGATGACAGGAGGGGTGGAAGG - Intergenic
1151403500 17:73871679-73871701 CAGCAGCAAGGAAGGGTTGAGGG + Intergenic
1151409537 17:73912686-73912708 CTGAAGACAGGAAGGAAGGAAGG - Intergenic
1151558477 17:74859053-74859075 GGGCAGAATGGAGGGGTGGAGGG - Intronic
1151669641 17:75565016-75565038 GGGCAGACAGGAGGTGTGGCTGG - Intronic
1151867817 17:76816019-76816041 AGGAAGACAGGAAGGAAGGAAGG + Intergenic
1151885798 17:76922752-76922774 GGGAAGACAGGAAGGTTGGAGGG + Intronic
1152002337 17:77654594-77654616 GAGCAGACAGGAGGGGTGGGAGG - Intergenic
1152044676 17:77928122-77928144 GGGCAGACAGGAGGCCTGGATGG + Intergenic
1152089775 17:78240107-78240129 CTGCAGAGAGGAAGGGTCGGGGG - Exonic
1152133645 17:78491797-78491819 GGGCTGACAGGGAGGGTGCAGGG - Intronic
1152263265 17:79278553-79278575 CAGCACACAGGCAGGGTGGGGGG - Intronic
1152535586 17:80948811-80948833 CAGCAGACAGGCAGGGAGGTCGG - Intronic
1152546820 17:81004320-81004342 CCGCAGCCAGGAAGGGCGGGGGG - Intronic
1152552377 17:81035914-81035936 GGGCAGGCTGGATGGGTGGACGG + Intronic
1152795628 17:82304708-82304730 GGGAAGAGAGGAAGGGAGGAGGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153612551 18:6900953-6900975 CGGAAGCCATGAAGGCTGGAAGG + Intronic
1153977037 18:10278511-10278533 AGGCAGGCAGGAAGGAAGGAAGG - Intergenic
1154441139 18:14391623-14391645 AGGCAGACAGGATGTGGGGAAGG + Intergenic
1155358143 18:24973515-24973537 TGGTAGAAGGGAAGGGTGGAGGG - Intergenic
1156281977 18:35648073-35648095 AGGAAGTGAGGAAGGGTGGAAGG + Intronic
1156423018 18:36976573-36976595 GGGAAGAAAGGAAGGATGGATGG + Intronic
1156752433 18:40475380-40475402 CAGCACAGAGGAAAGGTGGAAGG + Intergenic
1156966900 18:43105467-43105489 AGGAAGAGAGGAAGGGAGGAAGG + Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157336148 18:46738941-46738963 CAGGAGAGAGGAAGGCTGGAGGG + Intronic
1157411832 18:47469524-47469546 GGGCAGGCAAGAAGGGAGGAAGG - Intergenic
1157442504 18:47721563-47721585 AGGAAGACAGGGAGGATGGAGGG + Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158159161 18:54460633-54460655 AGGCAGGCAGGAAGGATTGAAGG - Intergenic
1158528159 18:58234188-58234210 AGGGAGGCAGGAAGGGGGGAAGG - Intronic
1159076005 18:63682847-63682869 AGGCAGGCAGGAAGGAAGGAAGG - Intronic
1159134297 18:64318965-64318987 AGGCAGGCAGGCAGGGAGGAAGG - Intergenic
1159139336 18:64373527-64373549 AGGCAGAAAGGAAGGGAGGGAGG - Intergenic
1159563860 18:70025782-70025804 GGGCAGACAGGAAGGATGAATGG - Intronic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1160194098 18:76738878-76738900 AGGAAGAAAGGAAGGGAGGAAGG - Intergenic
1160435542 18:78849498-78849520 AGGAAGACAGGAAGGCAGGAAGG + Intergenic
1160471891 18:79143100-79143122 AGACAGACAGAAAGGGAGGAAGG + Intronic
1160709649 19:545097-545119 CGGGAGAAAGGAAGGAGGGATGG - Intronic
1161531818 19:4794128-4794150 AGGCAGACAGGATGTGGGGAAGG - Exonic
1161551697 19:4916593-4916615 CAGCACACAGGACGGGTGGAGGG - Intronic
1161635455 19:5385983-5386005 AGGCAGGCAGGAAGGAAGGAAGG + Intergenic
1161881229 19:6954428-6954450 AGGAAGAAAGGAAGGGTGGGTGG + Intergenic
1161890053 19:7028701-7028723 AGGAAGACAGGAAGGAAGGAAGG + Intergenic
1161891399 19:7042045-7042067 AGGAAGACAGGAAGGAAGGAAGG - Intergenic
1161893484 19:7060502-7060524 AGGAAGACAGGAAGGAAGGAAGG - Intergenic
1162875676 19:13619087-13619109 CGGAAGAAAGGAAGGAAGGAAGG + Intronic
1163209955 19:15832944-15832966 GGGCAGACAGCAAGTGTGAAAGG - Intergenic
1164731002 19:30504439-30504461 AGGGAGAAAGGAAGGGAGGAAGG - Intronic
1164737209 19:30550566-30550588 AGGAAGGCAGGAAGGGAGGAGGG + Intronic
1164793090 19:31004569-31004591 AGGCAGGCAGGAAGGCAGGAAGG - Intergenic
1165758702 19:38308539-38308561 AGGCCAAGAGGAAGGGTGGATGG + Intronic
1165894169 19:39131577-39131599 TGGCCCACAGGAAGGTTGGAGGG + Intronic
1166195848 19:41205498-41205520 AGGAAGACAGGAAGGGAGGAAGG - Intronic
1166692752 19:44833547-44833569 AGGAAGGCAGGAAGGGAGGAAGG + Intergenic
1166752573 19:45171453-45171475 CGGATGAAAGGAAAGGTGGAAGG + Intronic
1166960442 19:46493462-46493484 CGGAGGACAGGAAGAGGGGAGGG + Exonic
1167229089 19:48270469-48270491 AGGGAGAGAGGAAGGGGGGAAGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168307436 19:55443035-55443057 CAGGAGGCAGGAAGGGCGGAGGG + Intergenic
1168427865 19:56253320-56253342 GGGCAGGGAGGAGGGGTGGAGGG + Intronic
1168639433 19:58020974-58020996 AGGCAGGCAGGAAGGGAAGAAGG + Intergenic
1168697888 19:58415756-58415778 CATAAGACAGGAAAGGTGGAAGG - Intronic
1168699120 19:58425428-58425450 AGGAAGACAGGAAGGAAGGAAGG - Intergenic
925017649 2:543807-543829 TGGGAGACAGGCAGGCTGGAGGG + Intergenic
925091399 2:1158855-1158877 CGGAAGACAGGAATGGTAGTTGG + Intronic
925430543 2:3788806-3788828 GGGAAGGCAGGAAGGGAGGAAGG - Intronic
925493993 2:4425900-4425922 AGGAAGAGAGGAAGGGAGGAAGG + Intergenic
926061971 2:9810017-9810039 CTGCAGCAAGGATGGGTGGATGG + Intergenic
926130975 2:10302958-10302980 CGGCAGCCAGGGAGGGAGCAAGG - Intronic
926399985 2:12487330-12487352 AGGAAGAGAGGAAGGGAGGAAGG + Intergenic
926692360 2:15746244-15746266 AGGAATGCAGGAAGGGTGGAGGG - Intergenic
927019117 2:18999323-18999345 AGGGAGACAGGGAGGGAGGAAGG - Intergenic
928259100 2:29750702-29750724 AGGCAGGCAGGAAGGAAGGAAGG + Intronic
928373751 2:30759070-30759092 AGGCAGAGAGGAAGGGAGGGAGG - Intronic
928502249 2:31908856-31908878 GGTCAGACAAGAAGGCTGGAGGG - Intronic
928510106 2:31994967-31994989 AGGGAGAGAGGAAGGGAGGAAGG + Intronic
928926396 2:36584145-36584167 TGGCAGACTGGAAGGTGGGATGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929586885 2:43121946-43121968 AGGGAGGCAGGAAGGGTGGGGGG - Intergenic
930146220 2:48007758-48007780 AGGCAGGCAGGAAGGAAGGAAGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931826315 2:66004243-66004265 GGGAAGGAAGGAAGGGTGGAGGG - Intergenic
932029845 2:68172225-68172247 CCGCAGCCAGGCAGGGTGGTGGG + Intronic
932421803 2:71605678-71605700 CTGCAGCCTGGATGGGTGGATGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933626577 2:84607487-84607509 GGGGAGAGAGGAAGGGTGCAAGG + Intronic
933849712 2:86356152-86356174 AGGCAGTCAGGAAGGGGAGATGG + Intergenic
934039832 2:88118573-88118595 AGGCAGAGAGGAGGCGTGGAGGG + Intergenic
934141591 2:89052482-89052504 GGGCAGACAGTAAGTGTGAAAGG - Intergenic
934227652 2:90148061-90148083 GGGCAGACAGTAAGTGTGAAAGG + Intergenic
934606765 2:95701008-95701030 AGGCAGGCAGGAAGGAAGGAAGG + Intergenic
934673725 2:96234411-96234433 CAGGAGACAGGAATGGAGGAGGG - Intergenic
934712230 2:96523645-96523667 AGGCAGGCAGGAAGGAAGGAAGG + Intergenic
935942834 2:108259270-108259292 CTGCAAACAGGCAGGGTGAAGGG - Intronic
936355194 2:111744058-111744080 AGGCAGGCAGGAAGGAAGGAAGG - Intergenic
936369295 2:111890112-111890134 AGGCAGGAAGGAAGGGAGGAAGG - Intergenic
936540161 2:113343122-113343144 AGGCAGGCAGGAAGGAAGGAAGG + Intergenic
937072206 2:119073113-119073135 AGGCAGGCAGGAAGGAGGGATGG + Intergenic
937072271 2:119073326-119073348 AGGCAGGCAGGGAGGGAGGAAGG + Intergenic
937072292 2:119073405-119073427 AGGAAGAAAGGAAGGGAGGAAGG + Intergenic
937241136 2:120463425-120463447 CAGAAGCCAGGAAGGGTAGAAGG + Intergenic
937270876 2:120651471-120651493 AGGAAGAAAGGAAGGGAGGAAGG + Intergenic
937435756 2:121879770-121879792 GGTAAGACAGGAAGGCTGGAGGG + Intergenic
937686453 2:124703254-124703276 AGGCAGACAGGAAGGCAGGAAGG - Intronic
937868254 2:126769841-126769863 GGGCAGAGAAGAAGGGTAGAAGG - Intergenic
938519123 2:132048670-132048692 AGGGAGAAAGGAAGGGAGGATGG - Intergenic
938662192 2:133498530-133498552 CGGCAGGGAGGAAGGGAGGGAGG + Intronic
939068258 2:137509358-137509380 AGGAAGAAAGGAAGGGAGGAAGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939444843 2:142295680-142295702 AGGCAGGCAGGAAGGGTGGAAGG - Intergenic
940229107 2:151431224-151431246 TTGCAGACAGGAAGGAGGGAAGG + Intronic
941219613 2:162759683-162759705 AGGCAGGCAGGAAGGAAGGAAGG + Intronic
941233991 2:162946550-162946572 AGGAAGACAGGAAGGAAGGAAGG + Intergenic
941420580 2:165278977-165278999 AGGCAGGCAGGAAGGAAGGAAGG + Intronic
941933903 2:170968509-170968531 CGGCAGTCATGAAGGCTGGAGGG + Intergenic
942136024 2:172926073-172926095 AGGCAGACAGGAAGGAAAGAAGG + Intronic
942444605 2:176069705-176069727 GGGCAGCCGGCAAGGGTGGATGG + Intergenic
943446305 2:187992056-187992078 AGGGAGGCAGGAAGGGAGGAAGG + Intergenic
943615574 2:190088100-190088122 TGGCAGAAAGGAAATGTGGAAGG + Intronic
943720207 2:191196362-191196384 CAGCAGACTGGAAGGCAGGAAGG + Intergenic
944963122 2:204899265-204899287 AGGAAGACAGGAAGGAAGGAAGG - Intronic
945859614 2:215105689-215105711 GGGGTGACAGGAAGGATGGAAGG + Intronic
945910720 2:215646151-215646173 TGGCTGCCTGGAAGGGTGGAGGG + Intergenic
946039477 2:216771493-216771515 AGACAGACAGGAAGGAAGGAAGG - Intergenic
946160203 2:217831264-217831286 CAACAGACAGGAAGGCTGCAAGG + Intronic
946368709 2:219267018-219267040 CAGCAGATGGGCAGGGTGGAGGG - Intronic
947279847 2:228438390-228438412 AGGAAGAAAGGAAGGGAGGAAGG - Intergenic
947925933 2:233922591-233922613 AGGGAGACAGGGAGGCTGGAGGG - Intronic
948020605 2:234730238-234730260 CAGCAGAGAGGAAGCGTGCAAGG - Intergenic
948067358 2:235091147-235091169 AGGCAGACAAGAAGGAAGGAAGG - Intergenic
948297524 2:236873548-236873570 AGGAAGAGAGGAAGGGAGGAAGG - Intergenic
948297533 2:236873576-236873598 AGGAAGAAAGGAAGGGAGGAAGG - Intergenic
948428421 2:237902633-237902655 GGGCAGACAGGGAGCGGGGACGG - Intronic
948660824 2:239505548-239505570 CAGCAGACCTGAGGGGTGGAGGG - Intergenic
948827384 2:240579233-240579255 TGGCAGCCAGGAAGTGGGGAGGG + Exonic
948836722 2:240629463-240629485 CGGGTGCCAGGAGGGGTGGAGGG + Intronic
1168764435 20:372136-372158 AGGCAGGCAGGAAGGAAGGAAGG + Intronic
1168827430 20:823156-823178 CAGCAGAGAGGAAGGGAGGCGGG + Intergenic
1169199485 20:3701306-3701328 TGGCAGCCAGGGAGAGTGGAGGG - Intronic
1169314663 20:4580218-4580240 AGGCAGACAGGAAGGAAGGAGGG - Intergenic
1169473811 20:5911770-5911792 CGGGAGAGAGGGAGGGTTGAGGG + Intronic
1171297641 20:24032766-24032788 AGGAAGAAAGGAAAGGTGGAAGG - Intergenic
1171347701 20:24478433-24478455 TGGCAGACAGTGAGGCTGGACGG - Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172772171 20:37388259-37388281 TGGAAGACAAGAAGAGTGGAGGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1172974529 20:38896050-38896072 GGGAAGAAAGGAAGGGAGGAAGG - Intronic
1173251307 20:41365561-41365583 CGGGAGCCAGGCAGGGAGGAAGG - Intronic
1173350737 20:42243036-42243058 AGGCAGAAAGGAAGGGAGGGAGG + Intronic
1173531126 20:43770494-43770516 AGGGAGTCAGGAAGGGAGGAAGG - Intergenic
1173539684 20:43842268-43842290 CTGCAGACAGCAGGGGTAGATGG - Intergenic
1173640239 20:44596646-44596668 CAGGAGGCAGGAAGGATGGAAGG + Intronic
1174062768 20:47844150-47844172 AGGGAGAAAGGAAGGGAGGAAGG + Intergenic
1174102494 20:48138264-48138286 CGGGAGGGAGGAAGGGTGGGTGG - Intergenic
1174223124 20:48973492-48973514 CGGCAGAGAGGAAGTGCTGAAGG + Intronic
1174400836 20:50275031-50275053 CGGCACACAGGAAGCCTGGCGGG + Intergenic
1174535174 20:51245867-51245889 AGGCAGGGAGGAAGGGAGGAGGG - Intergenic
1174952320 20:55055860-55055882 AGGCAGGCAGGAAGGAAGGAAGG - Intergenic
1175288038 20:57850916-57850938 GGGAAGACAGGAAGGAAGGAGGG + Intergenic
1176085297 20:63293076-63293098 CGGCAGACAGGAAGGGTGGAGGG + Intergenic
1176102697 20:63371785-63371807 CTTCAGACCGGAAGGGTGGGTGG + Intronic
1176454918 21:6899553-6899575 AGGCAGACAGGATGTGGGGAAGG - Intergenic
1176833091 21:13764601-13764623 AGGCAGACAGGATGTGGGGAAGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178235363 21:30835364-30835386 CAGAAGACAGGCAGTGTGGAAGG - Intergenic
1179534940 21:42045342-42045364 CGAGAGGCAGGAAGAGTGGAAGG - Intergenic
1179669672 21:42937822-42937844 AGGAAGACAGGAAGCGGGGAGGG - Intergenic
1179818350 21:43922309-43922331 CAGCAAACAGGAAGCGTGGGGGG + Intronic
1180122241 21:45761578-45761600 CGCCAGACTGGAAGGAGGGACGG - Intronic
1180320048 22:11311419-11311441 AGGAAGAAAGGAAGGATGGAAGG - Intergenic
1181087234 22:20446710-20446732 GGGCAGTGAGGAAGGGTGGCTGG + Intronic
1181462587 22:23094373-23094395 CTGCTGGCAGGAAAGGTGGATGG + Intronic
1181490359 22:23257522-23257544 CGGCTGGCAGGCTGGGTGGATGG + Intronic
1182086704 22:27565790-27565812 AGGGAGAAAGGAAGGATGGATGG + Intergenic
1182408375 22:30158634-30158656 AGAGAGACAGGAAGGGAGGAAGG - Intronic
1184095602 22:42314660-42314682 GAGCAGACAGGAGGGGTGCAGGG - Intronic
1184116455 22:42425551-42425573 CGGCAGACAGGGAGGGAAGGAGG - Intronic
1184148245 22:42623906-42623928 AGGCAGTCAGGAAGGATGGGTGG + Intronic
1184507651 22:44914017-44914039 GGGAAGAGAGGAGGGGTGGAGGG + Exonic
1184646627 22:45898830-45898852 GGGCAGACAGGAAGGGAGCTGGG - Intergenic
1184835697 22:47019777-47019799 AGGCAGAGGGGAAGGATGGAGGG - Intronic
1184984049 22:48117368-48117390 AGGAAGAAAGGAAGGGAGGAAGG + Intergenic
1185011123 22:48315320-48315342 CTGCAAAGAGGAAGGGTGGGAGG - Intergenic
1185076202 22:48684217-48684239 CAGGAGACAGGAAGGGCTGAGGG - Intronic
949219845 3:1618579-1618601 AGGCAGGCAGGAAGGAAGGAAGG + Intergenic
949251053 3:1984248-1984270 AGGAAGACAGGAAGGGATGAAGG + Intergenic
949730842 3:7110966-7110988 GGGAAGACAGAATGGGTGGAGGG + Intronic
949768204 3:7550303-7550325 AGGAAGACAGGAAGGGAGGGAGG - Intronic
950151980 3:10694838-10694860 CAGCAGAGAGGGAGGGGGGAAGG - Intronic
950453772 3:13080427-13080449 AGGCAGAGATGCAGGGTGGAGGG + Intergenic
950471111 3:13186972-13186994 CGGCAGGAAGGAAGGAGGGAGGG - Intergenic
950546574 3:13641536-13641558 CAGCAGATAGGAAAGGAGGAAGG + Intergenic
950655531 3:14434005-14434027 TGGCAGAGAGGAAGAGGGGACGG - Intronic
950796049 3:15511518-15511540 TGGCAGACAGGAAGAGTGAGGGG + Intronic
950954015 3:17031415-17031437 CTGCAGACATGAAAGGAGGAAGG - Intronic
950992335 3:17452228-17452250 AGGAAGACAGGAAGGAAGGAAGG + Intronic
951114300 3:18841774-18841796 AGACAGACAGGAAGGGAAGAAGG - Intergenic
951193541 3:19798528-19798550 AGGAAGGCAGGAAGGGAGGAAGG + Intergenic
952215056 3:31270098-31270120 AGGAAGAAAGGAAGGGAGGAAGG + Intergenic
952507187 3:34017980-34018002 AGGAAGAGAGGAAGGGAGGAAGG - Intergenic
954322454 3:49841396-49841418 AGGTTGGCAGGAAGGGTGGAGGG - Intronic
954329404 3:49881532-49881554 AGGCAGACCGGACGGGTGCAAGG - Intergenic
954420503 3:50416545-50416567 GGGCAGACAGGAATGGTGGGGGG + Intronic
954629949 3:52042428-52042450 AGGCAGGCAGGAAGGCAGGAAGG + Intergenic
954706624 3:52484470-52484492 GGGCAGGCAGGCAGGGTGGGTGG - Intronic
954708756 3:52494812-52494834 AGGGAGGCAGGGAGGGTGGATGG + Intergenic
954802555 3:53195580-53195602 CTGCAGAGATGAAGGATGGATGG + Intergenic
955157239 3:56428534-56428556 AGGCAGAAAGGAAGGAAGGAAGG + Intronic
955364792 3:58301639-58301661 AGGCAGTCATGAAGGGTGAAGGG + Intergenic
955862602 3:63347625-63347647 TGGAAGGCTGGAAGGGTGGAGGG - Intronic
956183468 3:66539762-66539784 AGGCAGACAGAAAGGAAGGAAGG + Intergenic
956738751 3:72258827-72258849 AGGTACACAGGAAGGGAGGAGGG + Intergenic
956968250 3:74489455-74489477 AGGGAGAGAGGAAGGGAGGAAGG - Intronic
957175576 3:76803486-76803508 AGGGAGAGAGGAAGGGAGGAGGG + Intronic
957394731 3:79622494-79622516 CTGGAGCCAGGAAGGCTGGATGG + Intronic
958556116 3:95679042-95679064 AGGAAGAGAGGAAGGGAGGAAGG + Intergenic
958839722 3:99189060-99189082 AGGAAGACAGGAAGGAGGGAAGG + Intergenic
959219211 3:103494558-103494580 AGGCAGAAAGGAAGGAAGGAAGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960386093 3:117023717-117023739 AGGCAGGCAGGAAGGAAGGAAGG - Intronic
960386094 3:117023721-117023743 CGGCAGGCAGGCAGGAAGGAAGG - Intronic
960452402 3:117826530-117826552 TGGAAGAAAGGAAGGGAGGAAGG + Intergenic
960542535 3:118877485-118877507 AGGAAGACAGGAAGGAAGGAAGG + Intergenic
961081642 3:124033304-124033326 AGGGAGACAGGGAGGGTGGGAGG + Intergenic
961536913 3:127576057-127576079 GGGCAAGCAGGAAGGGAGGAAGG + Intronic
961654988 3:128436199-128436221 CTGAAGACTGGAAGGGTGGAAGG + Intergenic
962291042 3:134136583-134136605 AGGGAGGAAGGAAGGGTGGAAGG + Intronic
962351787 3:134661705-134661727 AGGAAGACAGGAAGGCTGGAAGG + Intronic
963179733 3:142341494-142341516 AGGAAGACAGGAAAGGAGGAAGG + Intronic
963405390 3:144856657-144856679 GGGAAGAAAGGAAGGGAGGAAGG - Intergenic
963932966 3:151023425-151023447 AGGCAGGCAGGAAGGAAGGAAGG + Intergenic
964203751 3:154147802-154147824 AGGCAGAGAGGAAGGGAGGGAGG - Intronic
964300972 3:155284559-155284581 GGGCAGACAGCAAGTGTGAAAGG + Intergenic
965205937 3:165719360-165719382 AGGCAGGCAGGAAGGAAGGAAGG + Intergenic
965461783 3:168974806-168974828 TGGCAGAGAGAAAGGGTGGGTGG + Intergenic
966938273 3:184728988-184729010 GGGCAGACATGGTGGGTGGAAGG - Intergenic
967525631 3:190489184-190489206 AGGAAGAGAGGAAGGATGGAAGG - Intergenic
968002829 3:195219479-195219501 AGGCAGGCAGGAAGGGAAGAAGG + Intronic
968486705 4:866409-866431 GGGCAGACGGGAAGGATGGTGGG + Exonic
968938130 4:3624288-3624310 CAGCAGGCAGGATGGGTGGGTGG + Intergenic
968949334 4:3682434-3682456 CGTCACAGATGAAGGGTGGAGGG + Intergenic
969102727 4:4781837-4781859 CGGGAGGCAGGAAGGAAGGAGGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969423164 4:7108902-7108924 GGGCAGAGAGGAGGGGTGGGTGG - Intergenic
971150316 4:24024445-24024467 AGGCAGACAGTGAAGGTGGAAGG - Intergenic
971343410 4:25790754-25790776 AGGAAGAAAGGAAGGGAGGAAGG + Intronic
972004523 4:34083148-34083170 AGGGAGGAAGGAAGGGTGGAAGG - Intergenic
972049531 4:34711709-34711731 AGGCAGAAAGGAAGGGAGGGTGG + Intergenic
972055514 4:34797149-34797171 AGGAAGACAGGAAGGCAGGAAGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975032431 4:69637921-69637943 AGGCAGGCAGGAAGGAAGGAAGG + Intronic
975032444 4:69637990-69638012 AGGCAGGCAGGAAGGAAGGAAGG + Intronic
975228463 4:71902924-71902946 AGGCAGAAAGGAAGGAGGGAGGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
976404859 4:84651937-84651959 GAGCAGACAGGAAGGAGGGAAGG - Intergenic
976453136 4:85215545-85215567 CAGCAGACAGGAAGGGTGGTAGG - Intergenic
976826454 4:89265725-89265747 AGGAAGGAAGGAAGGGTGGAAGG - Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977470277 4:97434810-97434832 AGGCAGGCAGGAAGGAAGGAAGG + Intronic
978454079 4:108868718-108868740 AGGAAGAAAGGAAGGGAGGAAGG + Intronic
978952196 4:114574304-114574326 AGGCAGGCAGGAAGGAAGGAAGG - Intergenic
978992956 4:115109046-115109068 AGGAAGAAAGGAAGGGAGGAAGG + Intronic
979394833 4:120174977-120174999 CGTGACACAGGAAGGGAGGAGGG - Intergenic
979918416 4:126469088-126469110 AGGCAGACAGGCAGGAAGGAAGG + Intergenic
979918422 4:126469112-126469134 AGGCAGGCAGGAAGGCAGGAAGG + Intergenic
980280592 4:130714330-130714352 GGGCAGAGAGGAAGAGAGGAAGG - Intergenic
980344532 4:131596154-131596176 AGGAAGAAAGGAAGGGAGGAAGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
981027156 4:140088260-140088282 AGGAAGAAAGGAAGGGAGGAAGG + Intronic
981027865 4:140094771-140094793 AGACAGACAGGAAAGGAGGAAGG - Intronic
982194794 4:152900114-152900136 AGGAAGGAAGGAAGGGTGGAAGG + Intronic
982261729 4:153500036-153500058 CGGAAGGGAGGAAGGGAGGAAGG - Intronic
982334593 4:154219977-154219999 AGGCAGTCAGGAAGGAAGGAAGG - Intergenic
983279888 4:165667043-165667065 AGGAAGACAGGAAGGAAGGAAGG + Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
983858954 4:172680422-172680444 AGGCATACAGGAAGGAAGGAGGG + Intronic
985544865 5:504502-504524 CGGCAGCCAGGGAGGGTGCCGGG + Intronic
985622493 5:962874-962896 CGGAAGACAGGCAGGGTGGACGG + Intergenic
985636167 5:1036866-1036888 TGGCAGGCAGGCAGTGTGGATGG + Intronic
985636174 5:1036902-1036924 TGGCAGCCAGGCAGTGTGGACGG + Intronic
985636193 5:1036990-1037012 TGGCAGGCAGGCAGTGTGGATGG + Intronic
985636201 5:1037026-1037048 TGGCAGGCAGGCAGTGTGGACGG + Intronic
985943260 5:3155817-3155839 CATCAGCCAGGAAGGGTGGATGG + Intergenic
986151834 5:5137119-5137141 TGGCAGAGAGGAAGGGTGGCAGG + Intergenic
986832166 5:11592143-11592165 AGGCAGGCAGGAAGGCAGGAAGG - Intronic
986832191 5:11592255-11592277 AGGAAGACAGGAAGGCAGGAAGG - Intronic
987341575 5:16944088-16944110 CGTCAGAAAGGAAGGAAGGAAGG + Intergenic
988113370 5:26852457-26852479 AGGAAGTCAGGAAGGATGGAAGG - Intergenic
988181424 5:27799090-27799112 AGGCAGGCAGGAAGGAAGGAAGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989000866 5:36758764-36758786 CAGAAGATAGGAAGGGTGGGGGG + Intergenic
989127953 5:38075121-38075143 GGGAAGGAAGGAAGGGTGGATGG + Intergenic
989165378 5:38428678-38428700 CTGCAGAGAGGCAGTGTGGAGGG - Intronic
989209784 5:38846968-38846990 AGGCAGGCAGGATGGATGGACGG - Intronic
989513819 5:42319091-42319113 AGGCAGGCAGGAAGGAAGGAAGG + Intergenic
989609537 5:43277972-43277994 AGGAAGGAAGGAAGGGTGGAAGG - Intronic
990477724 5:56177353-56177375 AGGAAGAAAGGAAGGGAGGAAGG - Intronic
990684727 5:58288467-58288489 CGGCAGCCAGGCTGGGGGGAGGG + Intergenic
990886660 5:60602113-60602135 AGGCAGGCAGGAAGGGAGGCAGG + Intronic
991092890 5:62710057-62710079 AGGGAGAAAGGAAGGGAGGAAGG - Intergenic
991429573 5:66530356-66530378 AGGGAGAAAGGAAGGGCGGAAGG - Intergenic
992071718 5:73154766-73154788 AGGGAGAGAGGAAGGGAGGAAGG - Intergenic
992097491 5:73376516-73376538 GGGCAGACAGAAAGGGTAGCGGG - Intergenic
992293037 5:75300158-75300180 AGGAAGACAGGAAGGAAGGAAGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993526681 5:88973738-88973760 AGGAAGAAAGGAAGGGAGGATGG + Intergenic
993799664 5:92317237-92317259 AGGAAGGCAGGAAGGGAGGAGGG - Intergenic
994130331 5:96219751-96219773 AGGCAGGCAGGAAGGAAGGAAGG + Intergenic
994673940 5:102797807-102797829 AAGCATACAGGAAAGGTGGAAGG - Intronic
995125359 5:108573270-108573292 AGGGAGGAAGGAAGGGTGGAAGG + Intergenic
995554083 5:113309869-113309891 AGGAAGAAAGGAAGGGGGGAAGG - Intronic
996644460 5:125797171-125797193 CTGCAGTAAGGAAGGGTGGCTGG - Intergenic
996885958 5:128353981-128354003 GGGGAGACAGGGAGGGAGGATGG - Intronic
997291871 5:132742926-132742948 AGGAAGGAAGGAAGGGTGGAAGG - Intergenic
997424868 5:133796305-133796327 CCGCAGACAGCAAGGCTGAAAGG - Intergenic
997585247 5:135039834-135039856 CGGGAGGCGGGAAGGGTGGGGGG + Intronic
997700479 5:135894802-135894824 CGGCAGGAAGGATGGGTGGCAGG - Intronic
997712746 5:136019679-136019701 CAGCAGAAAGGAAGGCTGCAGGG - Intergenic
997748834 5:136325432-136325454 AGGAAGAAAGGAAGGGAGGAAGG - Intronic
998105998 5:139469600-139469622 CTCCAGACTGGAAGGGAGGATGG + Intergenic
998704339 5:144741247-144741269 AGGAAGAGAGGAAGGGAGGAAGG - Intergenic
998968801 5:147569079-147569101 AGCCAGACAGGCAGGGTAGAGGG - Intergenic
1000194300 5:158942980-158943002 AGGAAGAGAGGAAGGGAGGAAGG + Intronic
1000202341 5:159023882-159023904 GGGCAAACAGGAGGAGTGGAAGG + Intronic
1000930078 5:167240899-167240921 TGGGAAACAGGTAGGGTGGATGG + Intergenic
1001108472 5:168875705-168875727 AGGGAGACAGGAAGAGAGGAAGG + Intronic
1001511106 5:172322628-172322650 AGGAAGAAAGGAAGGGTGGGAGG - Intergenic
1001567128 5:172706996-172707018 CGGCTGCCAGGCAGGATGGATGG + Intergenic
1001860790 5:175053080-175053102 CAGCTGGCAGGAAGGATGGAAGG - Intergenic
1001877412 5:175213434-175213456 AGGAAGAAAGGAAGGGAGGAAGG - Intergenic
1001956974 5:175854315-175854337 TGGCAGGCAGCAAGGGTGGCAGG - Intronic
1002048731 5:176556966-176556988 AGGAAGAGAGGAAGGGAGGAAGG - Intronic
1002175968 5:177401498-177401520 CGGCAGGAAGGAAGGAAGGAAGG - Intergenic
1002563134 5:180096157-180096179 AGGAAGACAGGAAGGGAGGAAGG - Intergenic
1002563165 5:180096255-180096277 AGGAAGACAGGAAGGAAGGAAGG - Intergenic
1002563202 5:180096361-180096383 AGGAAGACAGGAAGGGAGGAAGG - Intergenic
1002647792 5:180669747-180669769 AAGCAGAAAGGAAGGGAGGAAGG + Intergenic
1003899856 6:10644482-10644504 AGGCAGGCAGGAAGGAAGGAAGG - Intergenic
1004137148 6:12978402-12978424 CGGCAGACAGCATGAGTGGCTGG - Intronic
1004277612 6:14252510-14252532 CCCCAGACAGGCAGGTTGGAGGG - Intergenic
1004420607 6:15466171-15466193 GGGGAGAGAGGAAGGCTGGAGGG + Intronic
1004466249 6:15887923-15887945 CTTCACACAGGATGGGTGGAGGG + Intergenic
1004816748 6:19319323-19319345 CGGAAGAATGGAAGGATGGAAGG - Intergenic
1005037121 6:21566849-21566871 AGGAAGACAGGAAGGAAGGAAGG - Intergenic
1005224335 6:23623514-23623536 AGGGAGAGAGGAAGGGAGGAAGG + Intergenic
1005224371 6:23623638-23623660 AGGAAGACAGGAAGGGAGGGAGG + Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006421937 6:33940049-33940071 AGGCAGACACACAGGGTGGAAGG + Intergenic
1006598278 6:35209279-35209301 GGGCAGAGAGGAGGGGTGGGAGG + Intergenic
1006958197 6:37896633-37896655 AGGCAGGCAGGAAGGCAGGAAGG - Intronic
1007398040 6:41588240-41588262 CCGCAGACAGGCAGGGCGGGAGG + Intronic
1007726730 6:43921318-43921340 GGGCAGAAAGGAAGCCTGGAAGG + Intergenic
1007777811 6:44233551-44233573 AGGCAGACAGGGAGGGAGGCAGG - Exonic
1008491166 6:52088641-52088663 CAGCAGGCAGGCAGGGTGGTGGG - Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008612563 6:53197686-53197708 TGGAAGAAAGGAAGGGAGGAAGG + Intergenic
1008869902 6:56260706-56260728 AGGCAGGCAGGAAGGGAGGCAGG + Intronic
1008869906 6:56260722-56260744 AGGCAGGCAGGAAGGAAGGAAGG + Intronic
1010230922 6:73534429-73534451 AGGAAGAAAGGAAGGGAGGAGGG + Intergenic
1010800473 6:80168705-80168727 AGGCAGGCAGGAAGGAAGGAAGG + Intronic
1011036878 6:82986932-82986954 AGGAAGAGAGGAAGGGAGGAAGG - Intronic
1011458174 6:87575017-87575039 ATGCAGACAGGAAGGAAGGAAGG + Intronic
1011855723 6:91688407-91688429 AGGCAGAGAGGAAGGAAGGAAGG - Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013082747 6:106826792-106826814 AGGCAGGCAGGAAGGGAGGGAGG + Intergenic
1013304690 6:108837535-108837557 AGGCAGACAGGAAGGCAGGAAGG + Intergenic
1013461115 6:110376418-110376440 AGGAAGACAGGAATGGGGGAAGG + Intergenic
1013787181 6:113794968-113794990 CGGCAAGCAGGCAGTGTGGATGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014793252 6:125699285-125699307 CTCCAGAGAGGAAGGGAGGAGGG + Intergenic
1014888788 6:126816266-126816288 AGGAAGAAAGGAAGGGTGGAAGG - Intergenic
1015862528 6:137695823-137695845 CTGTAGGCAGGAAGGGTGGGCGG - Intergenic
1018265083 6:162015588-162015610 GGGGAGAAAGGAAGGGAGGAGGG - Intronic
1018341097 6:162851939-162851961 AGGGAGAAAGGAAGGGAGGAAGG + Intronic
1018810274 6:167293794-167293816 CTGCAGCCAGAAAGGGTGAAAGG - Intronic
1018887910 6:167957040-167957062 AGGCAGGCAGGCAGGCTGGAGGG - Intronic
1018889737 6:167975305-167975327 CTGCATACAGCAAGGCTGGAGGG + Intergenic
1018963325 6:168464265-168464287 CGGAAGGAAGGAAGGATGGAAGG + Intronic
1019196631 6:170286981-170287003 AGGCAGGGAGGAAGGGTGGGAGG + Intronic
1019447808 7:1080509-1080531 CGGCCGCCAGGTTGGGTGGAGGG + Intronic
1019548816 7:1592211-1592233 CGGCCGACAGGAAGCATGGCTGG + Intergenic
1019563569 7:1669329-1669351 CGGGGGACAGGAAGCGGGGAGGG + Intergenic
1019737176 7:2656347-2656369 CCAGAGACAGGGAGGGTGGAGGG - Intronic
1019764701 7:2842010-2842032 AGGGAGAAAGGAAGGGAGGAAGG + Intronic
1019781423 7:2942406-2942428 AGGAAGAAAGGAAGGGAGGAAGG - Intronic
1019911888 7:4105801-4105823 TTGCAGAGAGGAGGGGTGGAAGG + Intronic
1020029152 7:4920717-4920739 CGGAAGAGAGAAAGGGAGGAAGG - Intronic
1020240379 7:6389958-6389980 GGGAAGAAAGGAAGGGAGGAAGG - Intronic
1020942577 7:14559924-14559946 AGGAAGAGAGGAAGGGAGGAAGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022266889 7:28765572-28765594 AGGTAGACAGGAAGGGAGAAAGG + Intronic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023199869 7:37685353-37685375 AGGCAGGCAGGAAGGAAGGAGGG - Intronic
1023241166 7:38149144-38149166 AGGCAGAAAGGAAGGATGGGAGG + Intergenic
1023798866 7:43815538-43815560 CAGCAGAGAGGAAAGGTGGGGGG + Intergenic
1024099489 7:46015712-46015734 CTGGAGCCAGGGAGGGTGGACGG + Intergenic
1024170511 7:46780426-46780448 AGGAAGACAGGAAGGAAGGAAGG + Intergenic
1024250276 7:47501134-47501156 AGGAAGAGAGGAAGGGAGGAAGG + Intronic
1024319606 7:48051647-48051669 AGGAAGAAAGGAAGGGAGGAAGG - Intronic
1024621771 7:51165053-51165075 AGGAAGACAGGAAGGGAGGGAGG + Intronic
1024774097 7:52762316-52762338 AGGCAGGCAGGAAGGAAGGAAGG - Intergenic
1024774106 7:52762348-52762370 AGGCAGGCAGGAAGGCAGGAAGG - Intergenic
1024914993 7:54488926-54488948 AGGAAGACAGGAAGGCAGGAAGG - Intergenic
1026104440 7:67409988-67410010 AGGCAGAGAGGGAGGGAGGAGGG - Intergenic
1026133161 7:67636856-67636878 AGGAAGAAAGGAAGGGAGGAAGG - Intergenic
1026145279 7:67741137-67741159 AGGCAGGCAGGAAGGAAGGAAGG - Intergenic
1026229801 7:68472875-68472897 GGGCAGAGAGGAAGTGTGGGAGG - Intergenic
1026241762 7:68581543-68581565 GGGAGGACAGGAAGGGAGGAAGG + Intergenic
1026578898 7:71597608-71597630 AGGCAGACAGGAAGGGCAGCTGG + Intronic
1026589174 7:71680820-71680842 AGGAAGAAAGGAAGGGGGGAAGG - Intronic
1026605901 7:71815709-71815731 AGGAAGAAAGGAAGGATGGAAGG - Intronic
1026878294 7:73892342-73892364 AGGCAGGCAGGAAGGAAGGAAGG - Intergenic
1027769915 7:82393128-82393150 AGGCAGGCAGGAAGGGAGGGAGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028439455 7:90842463-90842485 AGGCAGAAAGGAAGGGTGTTAGG + Intronic
1028456156 7:91040151-91040173 CTGCAGACAGGGCAGGTGGAAGG - Intronic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029041449 7:97580386-97580408 CTGGAGCCAGGAAGGCTGGATGG + Intergenic
1029114266 7:98229295-98229317 CGGAGGTCAGGCAGGGTGGATGG - Intronic
1030300726 7:107971765-107971787 AGACAGACAGGAAGTGTGTATGG + Intronic
1030360941 7:108595007-108595029 AGGCAGAGAGGGAGGGAGGAAGG - Intergenic
1031163546 7:118198669-118198691 TGGCAGACAGGAAGGCAAGAAGG + Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031264304 7:119564963-119564985 GGGCAGACAGGGAGGGAAGAGGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031933248 7:127708402-127708424 AGGAAGGCAGGAAGGGAGGAAGG - Intronic
1031950034 7:127882361-127882383 AGGCAGGCAGGAAGGGAGGGAGG + Intronic
1032284529 7:130530758-130530780 CAGAAGACAGACAGGGTGGAGGG + Intronic
1032285347 7:130535321-130535343 CAGAAGACAGACAGGGTGGAGGG + Intronic
1032286131 7:130539721-130539743 CAGAAGACAGACAGGGTGGAGGG + Intronic
1032490201 7:132318593-132318615 CGGAAAACAGGAAGGAAGGAGGG + Intronic
1032675814 7:134129089-134129111 AGGCAGGAAGGAAGGGAGGAAGG - Intronic
1032685669 7:134231555-134231577 CGGGAGGAAGGAAGGGAGGAAGG - Intronic
1032685716 7:134231691-134231713 CGGGAGGAAGGAAGGGAGGAAGG - Intronic
1032739281 7:134722767-134722789 TAGCAGAAAGGAAAGGTGGAGGG - Intergenic
1032743923 7:134766829-134766851 GGGCAGACAGGGAGGGAGGAAGG + Intronic
1033150878 7:138914017-138914039 AGGAAGAAAGGAAGGGAGGAAGG + Intronic
1033254035 7:139784116-139784138 AGGCAGGCAGGAAGGCAGGAAGG - Intronic
1033927763 7:146485286-146485308 CGGCAGACAGGCAGGCTGGGAGG + Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034334427 7:150311477-150311499 GGGCAGACAGTAAGTGTGAAAGG - Intronic
1034451545 7:151139695-151139717 CTGCAGCCTGGAGGGGTGGAAGG - Intronic
1034545636 7:151786825-151786847 AGGCAGGCAGAAAGGGTGGAGGG + Intronic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035337206 7:158137628-158137650 TGGCTGACAGGCAGGGTGCAGGG - Intronic
1035492048 7:159288451-159288473 CAGCAGAAAGGAGGGGTTGATGG - Intergenic
1036146504 8:6259203-6259225 AGGCAGGCAGGAAGGAAGGAAGG + Intergenic
1036221329 8:6923455-6923477 AGTCAGATAGGAAGGGTGGGGGG - Intergenic
1036255945 8:7206642-7206664 TGGAAGGAAGGAAGGGTGGATGG + Intergenic
1036361543 8:8080857-8080879 TGGAAGGAAGGAAGGGTGGATGG - Intergenic
1036474155 8:9077888-9077910 TGGCAGAAAGAAAGGTTGGATGG - Intronic
1036508459 8:9378423-9378445 AGGCAGGCAGGAAGGCAGGAAGG + Intergenic
1036889430 8:12586166-12586188 TGGAAGGAAGGAAGGGTGGATGG + Intergenic
1037010026 8:13829974-13829996 AGGCAGGCAGGAAGGCAGGAAGG - Intergenic
1037598704 8:20375335-20375357 AGGAAGAAAGGAAGGGTGGGTGG - Intergenic
1038156192 8:24992609-24992631 CAGCAGCCAGGAAAGGTGTAGGG + Intergenic
1038697464 8:29819029-29819051 CTGCAGGCAGGTAGTGTGGAGGG - Intergenic
1038941745 8:32312805-32312827 AGGCAAACAGGAAGGATGGAAGG - Intronic
1039223972 8:35367310-35367332 TGGCAGACAGGAACTGTGGAAGG - Intronic
1039347192 8:36719150-36719172 AGGGAGAAAGGAAGGATGGAAGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039771691 8:40694201-40694223 CTGCAGGCAGTAAGGGAGGATGG + Intronic
1039906168 8:41787831-41787853 AGGCAGGCAGGAAGGAAGGAAGG + Intronic
1040666969 8:49645398-49645420 CGGAAGAAAGGAAGGAAGGAAGG - Intergenic
1041098138 8:54369880-54369902 AGGCAGACAGGGAGGGAGGGAGG - Intergenic
1041623489 8:59999768-59999790 CGGCAGGCTGGAGGGCTGGAGGG - Intergenic
1041867578 8:62594792-62594814 GGGAAGAAAGGAAGGGAGGAAGG - Intronic
1042044445 8:64632922-64632944 CGACAGAAAGGAAGGGGGGCGGG + Intronic
1043094268 8:75946511-75946533 CGGAAGACAGGAAGGAAGGAAGG - Intergenic
1043313093 8:78886347-78886369 GGGCAGGCAGGAAGGCAGGAAGG - Intergenic
1044206231 8:89494523-89494545 CTGCAGACAGCAAGGCTGAAAGG + Intergenic
1044556859 8:93572185-93572207 GGGCAAACAGGGAGGGTGGCAGG - Intergenic
1044785498 8:95788391-95788413 AGGAAGAAAGGAAGGGAGGAAGG - Intergenic
1045359040 8:101415037-101415059 TGGCAGATAGGAAGGTGGGAAGG + Intergenic
1045755339 8:105534458-105534480 AGGAAGAAAGGAAGGGAGGAAGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046554717 8:115760743-115760765 AGGAAGAAAGGAAGGGAGGAAGG - Intronic
1046588481 8:116176566-116176588 AGAGAGAGAGGAAGGGTGGAAGG + Intergenic
1047211093 8:122841156-122841178 GGGAAGACAGGCAGGGAGGAAGG - Intronic
1047511883 8:125521770-125521792 AGGCAGGAAGGAAGGCTGGAAGG - Intergenic
1047536501 8:125724954-125724976 GGTGAGACAGGAAGTGTGGATGG + Intergenic
1047549073 8:125850115-125850137 CGGAAGAAAGGAAGGAAGGAAGG - Intergenic
1047767693 8:128002918-128002940 AGGGAGACAGGGAGGGAGGAAGG - Intergenic
1048127006 8:131646967-131646989 AGGCAGAAAGGAAGGCGGGAAGG + Intergenic
1048127017 8:131647035-131647057 AGGCAGACAGAAAGGAAGGAAGG + Intergenic
1048408091 8:134143160-134143182 AGGAAGGAAGGAAGGGTGGAAGG - Intergenic
1048901896 8:139046906-139046928 AGGCAGGCAGGAAGGAAGGAAGG - Intergenic
1048901911 8:139046966-139046988 AGGCAGGCAGGAAGGCAGGAAGG - Intergenic
1049141847 8:140962238-140962260 AGGAAGAAAGGAAGGGAGGAAGG + Intronic
1049397037 8:142405691-142405713 GGGTAGAGAGGAAGGGTGGGAGG - Intergenic
1049561872 8:143316165-143316187 GGGCAGACAGGGAGGGTGGCCGG - Intronic
1049661331 8:143820927-143820949 GGGCAGAAAGGAAGGGAGGGAGG + Intronic
1050347931 9:4711213-4711235 CAGCAGAAAGGAAGGTGGGATGG + Exonic
1050819187 9:9856222-9856244 TGGCAGAGAGGAAGAGTGGCTGG - Intronic
1051388678 9:16539689-16539711 AGGGAGAAAGGAAGGGAGGAAGG + Intronic
1051547053 9:18288608-18288630 AGGAAGACAGGAAGGTAGGAAGG + Intergenic
1052211308 9:25906886-25906908 AGGAAGAAAGGAAGGGGGGAAGG + Intergenic
1052922367 9:33981793-33981815 AGGAAGGAAGGAAGGGTGGAAGG + Intronic
1053133049 9:35629621-35629643 AGGCAGCCAGGAAGGGAAGATGG + Intronic
1054453041 9:65413418-65413440 CAGCAGGCAGGATGGGTGGGTGG - Intergenic
1055708210 9:79031740-79031762 AGGCAGGCAGGAAGGAAGGAAGG + Intergenic
1055791922 9:79931580-79931602 CTGGAGAGAGGCAGGGTGGAGGG + Intergenic
1056574461 9:87844159-87844181 AGGCAGCCAGGAAGAGTGAAGGG - Intergenic
1057467751 9:95331108-95331130 CTGCAGACAGCAAAGGGGGAAGG + Intergenic
1057702992 9:97376993-97377015 CGGCACAGAGCAGGGGTGGAGGG - Intronic
1058316918 9:103580409-103580431 CAGCATACAAGAAGGGTGAAGGG + Intergenic
1059635933 9:116170709-116170731 TAGCAGAAAAGAAGGGTGGATGG - Intronic
1060180288 9:121529017-121529039 AGGCAGAGAGGAAGGGTGGAGGG + Intergenic
1060231203 9:121826892-121826914 GGGCAGGGAGGCAGGGTGGATGG + Intronic
1060592748 9:124829285-124829307 AGAAAGACAGGAAGGGAGGAAGG - Intergenic
1060763113 9:126273087-126273109 AGGCAGGAAGGAAGGATGGAAGG - Intergenic
1060763116 9:126273099-126273121 AGGCAGGCAGGAAGGCAGGAAGG - Intergenic
1060942348 9:127550165-127550187 AGGGAGCCAGGAAGGGTGGGGGG - Intronic
1061027903 9:128062483-128062505 CAGCAGAGAGGAAAGGAGGATGG + Exonic
1061350718 9:130062621-130062643 AGGCAGGCAGGAAGGCAGGAAGG - Intronic
1061369777 9:130191813-130191835 CGGCTGGCAGGAAAGGTGGGCGG - Intronic
1061552931 9:131348565-131348587 GGGCAGACAGTGAGGGTGGGAGG - Intergenic
1061828777 9:133277413-133277435 AGGCAGGAAGGAAGGGAGGAAGG + Intergenic
1062320010 9:135986275-135986297 GGGCAGACAGGGAGGCTGCAGGG - Intergenic
1185593022 X:1291247-1291269 AGGCAGAAAGGCAGGGAGGAAGG - Intronic
1185872087 X:3673012-3673034 AGGAAGAAAGGAAGGGAGGAAGG + Intronic
1185999135 X:4988964-4988986 AGGCAGGCAGGAAGGCAGGATGG - Intergenic
1186246581 X:7622354-7622376 AGGGAGACAGGAAGGGAGGGAGG - Intergenic
1186828781 X:13369139-13369161 AGGCAGGAAGGAAGGGAGGAAGG - Intergenic
1187372927 X:18725542-18725564 AGGCAGACTGCAAGGCTGGAGGG - Intronic
1187526486 X:20059613-20059635 AGGAAGGAAGGAAGGGTGGAAGG + Intronic
1188150384 X:26667290-26667312 AGGAAGGGAGGAAGGGTGGAAGG - Intergenic
1188319580 X:28719843-28719865 CAGCACACAGGAATGGGGGATGG + Intronic
1188515382 X:30980358-30980380 AGGCAGGCAGGAAGGAGGGAAGG - Intergenic
1189700534 X:43713981-43714003 AGAAAGACAGGAAGGGTGGATGG + Intronic
1189700798 X:43715239-43715261 GGGGAGAAAGGAAGGGTGGATGG + Intronic
1189700852 X:43715521-43715543 GAGGAGACAGGAAGTGTGGAAGG + Intronic
1189701633 X:43719442-43719464 GGGGATACCGGAAGGGTGGATGG + Intronic
1190203129 X:48381273-48381295 GGGAAGACAGGAAGGGAAGATGG - Intergenic
1190207409 X:48414136-48414158 GGGAAGACAGGAAGGGAAGATGG + Intergenic
1190500693 X:51075179-51075201 AGGGAGACAGGAAGGGAGGCAGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191826570 X:65372465-65372487 CAGGAGAGAGGAAGGGAGGAAGG + Intronic
1191826600 X:65372615-65372637 AGGGAGAGAGGAAGGGAGGAAGG + Intronic
1192017036 X:67342264-67342286 AGGCAGACAGAATGGATGGAGGG - Intergenic
1192237412 X:69304735-69304757 CTGCGGACAGGAATGGGGGAAGG - Intergenic
1192449595 X:71235684-71235706 AGGGAGACAGGCAGGGAGGAAGG - Intergenic
1192540096 X:71961429-71961451 CGGGAGGAAGGAAGGGAGGAAGG - Intergenic
1192560312 X:72123884-72123906 TGGCAGGCAGGAAGGGGAGAGGG + Intergenic
1194217758 X:91151842-91151864 CTGCAGAGAGGAACAGTGGAGGG - Intergenic
1195036918 X:100978762-100978784 AGGAAGACAGGAAGGAAGGAAGG - Intronic
1195121336 X:101756027-101756049 AGGCAGGCAGGAAGGCAGGAAGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195935731 X:110124201-110124223 AGGCAGGCAGGAAGGCAGGAAGG + Intronic
1195974573 X:110512536-110512558 CAGAAGACAGGAAGGAAGGAAGG + Intergenic
1196207196 X:112954420-112954442 AGGCAGGCAGGAAGGAAGGAAGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196376658 X:115040241-115040263 CGGGATACAGAAAGGGGGGAGGG + Intergenic
1196630264 X:117930311-117930333 AGGCAGGCAGGAAGGCAGGAAGG + Intronic
1197253283 X:124236863-124236885 AGGCAGGCAGGAAGGAAGGAAGG - Intronic
1197602157 X:128543462-128543484 CTGCAGCCAGGGAGGCTGGACGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198455433 X:136812880-136812902 AGGAAGAGAGGAAGGGAGGAAGG + Intergenic
1198486991 X:137097294-137097316 TGGCACAAAGAAAGGGTGGAGGG + Intergenic
1200554266 Y:4615638-4615660 CTGCAGAGAGGAACAGTGGAGGG - Intergenic
1200559706 Y:4686259-4686281 AGGCAGACAGGCAGGGAGGGAGG + Intergenic
1201256393 Y:12112243-12112265 AGGAAGGCAGGAAGGGAGGAAGG - Intergenic
1201461542 Y:14230815-14230837 AGGCAGGCAGGAAGGAAGGAAGG + Intergenic
1201696168 Y:16828935-16828957 AGGAAGAGAGGAAGGGAGGAAGG + Intergenic
1201698549 Y:16854352-16854374 TGTCAAACAGGAAGGATGGAGGG - Intergenic
1201914825 Y:19170889-19170911 GGGCAGACAGGTAGGTGGGATGG - Intergenic
1202275344 Y:23112893-23112915 CGGGAGACAGGAAGCAGGGAAGG + Intergenic
1202290684 Y:23307798-23307820 CGGGAGACAGGAAGCAGGGAAGG - Intergenic
1202367713 Y:24178450-24178472 CGGAAGACACTTAGGGTGGATGG - Intergenic
1202428336 Y:24746612-24746634 CGGGAGACAGGAAGCAGGGAAGG + Intergenic
1202442455 Y:24923477-24923499 CGGGAGACAGGAAGCAGGGAAGG - Intergenic
1202503070 Y:25491673-25491695 CGGAAGACACTTAGGGTGGATGG + Intergenic