ID: 1176086748

View in Genome Browser
Species Human (GRCh38)
Location 20:63298907-63298929
Sequence GGGCACCGGGGCACCCGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176086748_1176086759 12 Left 1176086748 20:63298907-63298929 CCGTCCCGGGTGCCCCGGTGCCC 0: 1
1: 0
2: 0
3: 16
4: 252
Right 1176086759 20:63298942-63298964 ACCCTCCCCTGCTCCCTGGACGG 0: 1
1: 0
2: 3
3: 51
4: 385
1176086748_1176086757 8 Left 1176086748 20:63298907-63298929 CCGTCCCGGGTGCCCCGGTGCCC 0: 1
1: 0
2: 0
3: 16
4: 252
Right 1176086757 20:63298938-63298960 GTCCACCCTCCCCTGCTCCCTGG 0: 1
1: 0
2: 3
3: 61
4: 571
1176086748_1176086767 30 Left 1176086748 20:63298907-63298929 CCGTCCCGGGTGCCCCGGTGCCC 0: 1
1: 0
2: 0
3: 16
4: 252
Right 1176086767 20:63298960-63298982 GACGGCCGCCTCCAACAGCATGG 0: 1
1: 0
2: 1
3: 2
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176086748 Original CRISPR GGGCACCGGGGCACCCGGGA CGG (reversed) Intronic
900101541 1:964208-964230 GGGCCCCGCGGCGCACGGGAGGG - Intronic
900190110 1:1349600-1349622 GGGCGCCGGGGCGCTCGGGTCGG + Intergenic
900560850 1:3305361-3305383 GGGCACCTGGGCCCCCTGCACGG - Intronic
901925208 1:12561659-12561681 GAGAACTGGGGCACCCTGGAAGG + Intergenic
901930799 1:12595408-12595430 GGGCCGCGGGGGTCCCGGGAGGG + Intronic
902490085 1:16775210-16775232 GGGCACCTCTGCACCGGGGAAGG + Intronic
902699035 1:18159014-18159036 AGGCACCAGGGAACCTGGGAGGG - Intronic
904299130 1:29542856-29542878 AGGAACCAGGACACCCGGGAAGG - Intergenic
913222157 1:116667907-116667929 GGGCACCGGAGGACCTGGGCAGG + Intergenic
915321676 1:155059989-155060011 GGGGACAGGGGCAGCTGGGAGGG + Intronic
915364973 1:155309886-155309908 GGGTACCCGTGCACCAGGGAGGG - Exonic
917876790 1:179293651-179293673 GGGGACCCGCGCGCCCGGGAAGG + Intergenic
918110309 1:181449901-181449923 GGGCACAGGGGCACATAGGAGGG + Intronic
919851176 1:201674065-201674087 GGGCACCTGGACACCTGGGCTGG - Intronic
919914299 1:202130326-202130348 GGGCCCCGGGGGCCCAGGGATGG + Exonic
920100953 1:203516773-203516795 GGGCACTGGGGCACTGGGGCAGG - Intergenic
922796351 1:228341626-228341648 AGCCACCTGGGCCCCCGGGAAGG - Intronic
922891199 1:229062947-229062969 GGGCACCAGGGCAGCCAGGCAGG - Intergenic
923328062 1:232898260-232898282 GTGCTCTGGGGCACCCGGGAAGG + Intergenic
923530352 1:234807320-234807342 GGGCACCTCTGCACCGGGGAAGG - Intergenic
923673958 1:236064724-236064746 GGCCGCCGGGGCACCGGGCACGG - Intronic
1064475975 10:15689825-15689847 GGGCACAGTGGCAACTGGGATGG - Intronic
1065599082 10:27350183-27350205 GGGCAGCGGGGCACAGGGGGTGG + Intergenic
1065898255 10:30183179-30183201 TGGCACCGGCGGACCCGGGCTGG - Intergenic
1067229138 10:44394831-44394853 GGGCACCAGAGCACCTGGGGGGG + Intergenic
1070792809 10:79199715-79199737 GGGCACCAGGGGACTGGGGACGG + Intronic
1070965719 10:80529125-80529147 GGGTACCAGGGGACCTGGGAGGG + Exonic
1073026400 10:100490056-100490078 GGGCACCTGGGTCCCCTGGAAGG + Exonic
1074546096 10:114403687-114403709 GGCGTCCGGCGCACCCGGGACGG + Intronic
1075123337 10:119680369-119680391 GGGCACAGAAGCACCCTGGATGG + Intergenic
1075207000 10:120456962-120456984 GGGCACCCGCGGACCGGGGAGGG - Exonic
1075778324 10:125001994-125002016 GGGCCCCGGTGCTTCCGGGACGG - Intronic
1076647314 10:131962025-131962047 GGGCACCGGTGCTCCCCGGAGGG - Intergenic
1076717743 10:132374930-132374952 GGGCCCCGGGGCAGCGGGGCTGG + Intronic
1076885263 10:133259176-133259198 CGGCCCAGGGGCACCGGGGAGGG + Intergenic
1077214811 11:1390830-1390852 GGCCACCGGGGCCTCCGGGCAGG + Intronic
1078987683 11:16610986-16611008 GAGCTCCGGGGAACCTGGGAGGG + Intronic
1079056076 11:17207763-17207785 GGGCCCCGGGGTTCCCGGGCTGG - Intronic
1079788118 11:24701258-24701280 GGGCATCTGGGCAGCAGGGATGG - Intronic
1082179679 11:49102575-49102597 GGGCACCCGGGCTCAGGGGAGGG + Intergenic
1083669577 11:64292399-64292421 GGGCGCGGGGGCACCCTGGAGGG + Intronic
1084121054 11:67069213-67069235 GGGAGCCGGGGATCCCGGGAGGG - Intronic
1086685603 11:89730337-89730359 GGGCACCCGGGCTCAGGGGAGGG - Intergenic
1089080862 11:115775298-115775320 GGGCCCCTGAGCACCCTGGAAGG + Intergenic
1089834429 11:121357602-121357624 GGGCACCAGGGAACCTGAGAAGG + Intergenic
1090190212 11:124762125-124762147 GGTCACCAGGGGCCCCGGGAGGG + Exonic
1091582288 12:1797177-1797199 GGGGACCGGGACAGCCGGGATGG - Intronic
1091789602 12:3264237-3264259 GGGCACAGGGGACCCGGGGAAGG + Intronic
1094155383 12:27332933-27332955 GGCCGCCGCGGCACCCGGCAGGG + Intronic
1096788428 12:54030938-54030960 GGGCGCCTGGGCTCCGGGGAAGG - Intronic
1096879803 12:54658458-54658480 GGGCACTGGGAGACCTGGGAGGG - Intergenic
1097189073 12:57210897-57210919 GGGCCCCAGGGCATGCGGGAGGG + Intronic
1103951999 12:124556312-124556334 GGGCACCAGGGCACGAGGCAAGG + Intronic
1105277486 13:18944290-18944312 CGGCGCAGGGGCAGCCGGGAAGG + Intergenic
1105781113 13:23705970-23705992 GGGCCCCGGGACTCCCTGGATGG + Intergenic
1106546042 13:30731907-30731929 GGGCACCGGGAGAGCCGGGGAGG - Intronic
1108050943 13:46438068-46438090 GGGCTCCGCGGCTCCCTGGACGG - Intronic
1108690029 13:52851331-52851353 GGGAGCCGGGGAGCCCGGGAAGG + Intergenic
1110558499 13:76886213-76886235 GGGTTCCGGGGCTCCGGGGAAGG - Exonic
1112771818 13:102800572-102800594 GGGCTCCGAGGCCGCCGGGACGG - Intronic
1113185256 13:107680070-107680092 GGGCACCTGGGCACTCAGGCAGG - Intronic
1116916850 14:50532978-50533000 TGGCAGCGGGGCGCCGGGGAAGG + Intronic
1118379994 14:65209668-65209690 AGGCACTGGGGTACCAGGGATGG + Intergenic
1119786763 14:77320388-77320410 GGGCACCATGGCAACCGCGACGG - Intronic
1119881799 14:78105576-78105598 GGGCACCAGGGCACCCTGGCAGG - Intergenic
1121127609 14:91417970-91417992 GGGCTCCCGGGCTCCCGGGCTGG - Intergenic
1121332473 14:93058226-93058248 GGCCACAGGGGCATCTGGGAGGG + Intronic
1121622836 14:95362023-95362045 AGGCACTGGGGCACTCGGAAGGG + Intergenic
1122234185 14:100322804-100322826 GGGAACCGGGGCAGCGGGAAGGG + Intergenic
1122327005 14:100887933-100887955 GGGCACAAGGGCACCCAGGCTGG - Intergenic
1122824091 14:104361259-104361281 GTGCACCGGGACATCAGGGAGGG - Intergenic
1131046345 15:89318885-89318907 GGGCAGAGGGGCCCCAGGGAGGG - Intronic
1131062514 15:89412668-89412690 GGGCTCCAGGGCACACGTGAAGG - Intergenic
1131310478 15:91285891-91285913 GGGCACAGGGGCAGGCGGGACGG + Intronic
1132687505 16:1168490-1168512 GGTGACCTGGGCACCCGGCAGGG - Intronic
1132880960 16:2161506-2161528 GGCCACCTGGGCCCCCGGGCAGG + Intronic
1135517659 16:23149132-23149154 GGGCCCCGGGGCGTCCGGGCCGG - Exonic
1136272875 16:29158840-29158862 GGTCACCGCGGCTCCCGGGCGGG + Intergenic
1136295851 16:29301653-29301675 GGGCACAGGGGAACAGGGGAAGG + Intergenic
1137722087 16:50633368-50633390 CGGCTCCGGGGCACCCAGGACGG + Exonic
1139529889 16:67537842-67537864 GGGCGCCGGGACGCCCGGGCCGG + Intronic
1139962575 16:70726321-70726343 GGGCACTGGGGCAACAGGGCCGG + Intronic
1141460646 16:84176813-84176835 GGGCAAAGGGGCACCAGGCAGGG + Intronic
1141810309 16:86371494-86371516 GGGGCACGTGGCACCCGGGAAGG + Intergenic
1142076429 16:88120652-88120674 GGTCACCGCGGCTCCCGGGCGGG + Intergenic
1142101770 16:88275840-88275862 GGGCACAGGGGAACAGGGGAAGG + Intergenic
1142156457 16:88534695-88534717 GGGTCCCGTGGCCCCCGGGACGG + Exonic
1142186623 16:88697839-88697861 GGGTACGGGGGCACTCGGAATGG + Intronic
1142292983 16:89201231-89201253 GGGCTGCGGGGCAGCAGGGACGG + Intronic
1142619380 17:1154999-1155021 GGCCCCCAGGGCGCCCGGGAAGG - Intronic
1142762757 17:2051321-2051343 GGGGACCGAGGCGACCGGGAGGG + Intergenic
1143375724 17:6465987-6466009 GGGCAGTGGGGAGCCCGGGAGGG - Intronic
1144608878 17:16690804-16690826 AGGCCCCACGGCACCCGGGATGG + Intronic
1144903942 17:18625016-18625038 AGGCCCCATGGCACCCGGGATGG - Intergenic
1145110356 17:20156455-20156477 GGGCGCCGGGGCCGCCGGGCAGG + Intronic
1145128642 17:20321726-20321748 AGGCCCCACGGCACCCGGGATGG + Intergenic
1145195981 17:20895589-20895611 AGGCCCCACGGCACCCGGGATGG - Intronic
1146718118 17:35103353-35103375 GGGCAGTGGGGAACCAGGGATGG + Intronic
1146820740 17:35982178-35982200 GGCCATGGGGGCACCCAGGAGGG - Intergenic
1147134687 17:38428305-38428327 GGCCGCCGGGGCACCCAGAAGGG + Intergenic
1147285764 17:39401704-39401726 GGGCCTCGGAGCGCCCGGGAGGG + Intronic
1147315526 17:39618275-39618297 GGGCACCGGGGCACCTCGCTGGG - Intergenic
1148128363 17:45248137-45248159 GGGCGCCGGGACCCGCGGGAGGG - Intergenic
1148145864 17:45364521-45364543 GGGCAGAGGGGAACCTGGGATGG - Intergenic
1150294590 17:64001193-64001215 GGGCAGCAGGGCACCCGGGGAGG - Exonic
1151632281 17:75319043-75319065 GGCCACCGGGGCAAGAGGGAAGG - Exonic
1152042817 17:77915635-77915657 GGGCACCGGGGAGCCATGGAGGG - Intergenic
1152146691 17:78572722-78572744 GAGCACCTGGGCAGCCTGGATGG - Exonic
1152306082 17:79520773-79520795 TGGCACCCGGCCAGCCGGGAGGG - Intergenic
1152341609 17:79728924-79728946 AGGCACCGGGGCTCCCGAGAGGG - Intergenic
1152531753 17:80922980-80923002 GGGTACCGGGGTGTCCGGGAGGG - Intronic
1152590418 17:81208873-81208895 GGGCACCTGAGGTCCCGGGAAGG + Intronic
1152820911 17:82437225-82437247 GGGCCCCGTGGCACCCTTGAAGG - Exonic
1152845359 17:82596470-82596492 GGGCACCAGGGCAACCGGTGGGG - Intronic
1153676438 18:7459979-7460001 GGGCACGGGGTCACTTGGGAAGG - Intergenic
1153813135 18:8769644-8769666 GGTCACCAGGCCACCTGGGATGG - Intronic
1154501017 18:14998117-14998139 GGGCTCCGGGGCCCCCGCGCTGG - Intergenic
1157386705 18:47263949-47263971 GGACTCCGGGACACCCAGGAAGG - Intergenic
1160517586 18:79487037-79487059 GTGCACCGAGGCACCGGGCAGGG + Intronic
1160748147 19:720936-720958 GGGCTCGGGGCCACCCCGGAGGG - Intronic
1160946280 19:1645431-1645453 GGGCAGCGGGGAGCCCTGGATGG - Intronic
1161024977 19:2032561-2032583 GGGCTCGGTGCCACCCGGGAGGG + Intronic
1161086498 19:2337982-2338004 GGGCACCAGGGTACCCAGAAAGG - Intronic
1161473399 19:4472465-4472487 GGGCAGCGGGGGCCCCGGGCCGG + Intronic
1161513130 19:4682812-4682834 GGTGACCGGGGCACCCGCGATGG + Exonic
1161859179 19:6784905-6784927 GGGCAGTGGGGAACCAGGGAAGG - Intronic
1162562070 19:11422675-11422697 AGGCACCGGGGCTCTGGGGAGGG - Intronic
1162799529 19:13103049-13103071 GGGCCCCAGGGCAGCCGGGGAGG + Intronic
1163152624 19:15424234-15424256 GGGGGCCGGGGCACCAGGGAGGG + Exonic
1163831034 19:19547280-19547302 GGCCTCCAGGGCACCTGGGATGG + Intergenic
1164590890 19:29506211-29506233 GGGCCCCGGGGGTCCTGGGATGG - Intergenic
1165429633 19:35765160-35765182 TGGCCCCAGGGCACCCGGTAAGG + Exonic
1165758943 19:38309468-38309490 GGACACCGGGTCAGCCAGGAAGG + Exonic
1166735233 19:45080005-45080027 GAGCACCGGGGCCACCAGGAGGG + Exonic
1166809362 19:45506653-45506675 GGGGGCGGGGGCTCCCGGGAGGG + Intronic
1166866161 19:45838673-45838695 GACCACCCGGGCACCCCGGAAGG - Intronic
1167102855 19:47414873-47414895 GGGCACCGGGGTACTGGGGGGGG + Intronic
1167852082 19:52209971-52209993 AGGCACTGTGGCACCCTGGAGGG - Intronic
1168287928 19:55343584-55343606 CGGCACAGAGGCACCCAGGAAGG - Intronic
1168300364 19:55401535-55401557 GGGCCCCAGGGGGCCCGGGAGGG - Exonic
1168413620 19:56155461-56155483 GGGCCCTGGGCCACCCGGGTGGG - Intronic
925419832 2:3703347-3703369 GGGCAACGGGGAGCCCGGGCAGG - Intergenic
925419866 2:3703458-3703480 GGGCGACGGGGAACCCGGGCAGG - Intergenic
932005735 2:67925291-67925313 GGGCACCAAGGCACCCATGAGGG + Intergenic
934559683 2:95306700-95306722 AGGCACTGGGGCTCCCGGCAGGG + Intronic
935594254 2:104867329-104867351 GGGAACCGAGGGGCCCGGGAGGG + Intergenic
937096053 2:119235895-119235917 GGGCACTGGGGCACTGGGGTCGG - Intronic
937716329 2:125037512-125037534 GGGCACTGGGGCAGCCCAGAGGG - Intergenic
938065519 2:128280121-128280143 GGGCACCGGGGGCCCCTGGTGGG - Intronic
938383518 2:130849391-130849413 GGGCACTGGGGCCCCAGGCAAGG - Intronic
938500188 2:131828306-131828328 GGGCTCCGGGGCCCCCGCGCTGG - Intergenic
940140379 2:150486069-150486091 GGGCACCGAGGCACCGCGGGCGG + Intronic
948214276 2:236216959-236216981 GTGCAGCGGGGCAACCTGGAAGG - Intronic
948368880 2:237475184-237475206 AGGCCCCGGGGTCCCCGGGAAGG + Intergenic
948457789 2:238114922-238114944 GGGCAGCACGGCACCCAGGAAGG + Intronic
948993244 2:241565012-241565034 GGGCACCTGGGGGCCAGGGAGGG + Intronic
949070968 2:242023901-242023923 GTGCAGCTGGACACCCGGGAAGG - Intergenic
1168811885 20:710019-710041 CGGCCCCGGGGGACGCGGGACGG - Intergenic
1170972204 20:21126288-21126310 GGGCCCCGGGGAACCTCGGACGG - Intronic
1171164330 20:22957172-22957194 GGGCAAAGGGGCAGCCTGGAAGG - Intergenic
1171972526 20:31573157-31573179 GGGCAGGGGGGCCCCCGGGCCGG + Intronic
1172449238 20:35010133-35010155 GGGAACGTGGGCAGCCGGGATGG + Intronic
1172765383 20:37348067-37348089 AGGCCCAGGGGCACGCGGGAGGG - Intronic
1173586647 20:44187505-44187527 GGGCACCGGGGAATCGGGGAAGG + Exonic
1174042376 20:47709099-47709121 GGGCCCCGGGGCTCCTGGGCTGG + Intronic
1174056374 20:47800944-47800966 GGGCATCTGGGCAGCAGGGAGGG + Intergenic
1174091473 20:48052144-48052166 GGGCATCTGGGCACCGGGCAAGG - Intergenic
1175424554 20:58855366-58855388 GGCCGCCGGGGAACCGGGGAGGG + Intronic
1176086748 20:63298907-63298929 GGGCACCGGGGCACCCGGGACGG - Intronic
1178403430 21:32306236-32306258 GGACTCCTGGGCCCCCGGGAGGG - Intronic
1179482836 21:41689296-41689318 GGTCACCGGGTCACCCTGCACGG + Intergenic
1179482856 21:41689352-41689374 GGTCACCGGGTCACCCCGCATGG + Intergenic
1179552409 21:42151423-42151445 GGGCAGCGGGGAGGCCGGGACGG - Intergenic
1179723484 21:43329215-43329237 GGAAACCGAGGCACCCAGGATGG + Intergenic
1179810370 21:43865669-43865691 GGGGTTCGGGGCGCCCGGGAGGG + Intronic
1179942458 21:44648988-44649010 GGGCACCCCGGGACCTGGGAGGG - Intronic
1180219556 21:46349558-46349580 GGGCCCGGGGGCGCCCAGGATGG + Intronic
1181079065 22:20401685-20401707 GGGCAGGGGGCCACCAGGGAAGG + Intronic
1181174046 22:21026049-21026071 GGGCACCGGGGCAGCTTGGCTGG + Exonic
1181472727 22:23150848-23150870 GGGCACAAGAGCACCCAGGAGGG - Intronic
1183586559 22:38756132-38756154 GGGCAGCGGGGCCCACGCGAGGG - Intronic
1184037835 22:41926818-41926840 GGGCTCCGGGGCCCTCGGGGAGG + Exonic
1184730719 22:46369657-46369679 GGGCACCCGGACTCCCGTGAAGG + Intronic
1185343060 22:50300079-50300101 GGGCGCCGGAGTCCCCGGGAGGG - Intronic
951954738 3:28241739-28241761 CGGCTCCGGGGCACGCAGGAAGG - Exonic
954150435 3:48654614-48654636 GTGCAAAGGGGCACCCGTGATGG + Intronic
954419819 3:50412912-50412934 GGGCACCGGGAGACCAGGGAGGG - Intronic
955502848 3:59602133-59602155 GGCCACCGGGGCAAGTGGGAGGG + Intergenic
956660900 3:71596415-71596437 GGGCACAGGGTCTCCCTGGATGG - Intergenic
960036909 3:113111087-113111109 GGGCACCAGGGCAGCAGGGTGGG + Intergenic
962350198 3:134650791-134650813 GGGGACCCGGGGACCCGGGTCGG + Intronic
963827582 3:149971227-149971249 GGGCACGGAGGGTCCCGGGAAGG + Intronic
965342231 3:167504333-167504355 GGGCACAGTGGCACCAGGGGTGG - Intronic
966875555 3:184319817-184319839 GGGCTCCGGGACATCTGGGAAGG + Intronic
967920257 3:194609208-194609230 GGGCAGCTGGGCAGCCGAGATGG + Intronic
968073260 3:195801430-195801452 GAGCCCCGGGGCCCCGGGGAGGG - Intronic
968230718 3:197003231-197003253 GGGCGGCGGGGCTCCCGGGGAGG + Exonic
968525930 4:1057184-1057206 GGGCCCGTGGGCACCCAGGAGGG + Intronic
968748120 4:2371621-2371643 AGGCACAGGGGCTCCCGGCAGGG + Intronic
968879586 4:3292384-3292406 GGGCCCCGGGACGCCCGCGAAGG - Intergenic
968904849 4:3446408-3446430 GGTTACCGGGGACCCCGGGAAGG - Intronic
969405146 4:6986781-6986803 GCGCCCCGGGGCTGCCGGGAGGG - Intronic
969583865 4:8080886-8080908 GGCCCCTGGGGCAGCCGGGAGGG + Intronic
985622466 5:962769-962791 AGGCCCCGGGGCACTCAGGACGG + Intergenic
985791545 5:1930999-1931021 GGGCACCGAGGCACCGAGGCGGG - Intergenic
985858242 5:2447802-2447824 GGGCACAGGAGGACCAGGGAGGG + Intergenic
997382703 5:133449140-133449162 GGGCACAGGGGCACGTGGGGCGG - Intronic
999286070 5:150395065-150395087 AGGCAGAGGGGCCCCCGGGACGG - Intronic
1001605683 5:172958564-172958586 GGGCACCGTGGCGGCAGGGAAGG - Intergenic
1003067581 6:2916881-2916903 GGGCACTGGCCCACCAGGGATGG + Intergenic
1003078145 6:3000103-3000125 GGGGACCGGGGGACTTGGGAAGG + Intronic
1003112433 6:3261158-3261180 GTGCACAGCGGCACCTGGGAAGG + Intronic
1004071421 6:12301415-12301437 GGGCACCAGAGCACGAGGGAGGG - Intergenic
1004396179 6:15248328-15248350 GGGCACCGGTCTACCCGGGCCGG + Intronic
1004690110 6:17986789-17986811 GGGCTGCGAGGCACCCGGGAGGG - Intronic
1007323676 6:41044231-41044253 CGGCACCAGGGGACCCAGGAGGG - Exonic
1017908622 6:158773717-158773739 AGGCAGCGGGGCTCCTGGGAAGG + Intronic
1018926787 6:168212429-168212451 GGGCAGCGGGGCAGCAGGCAGGG + Intergenic
1019285742 7:222090-222112 TAGCATCTGGGCACCCGGGAGGG + Intronic
1019543936 7:1564018-1564040 GGGCTCCAGGGCACCCTGCATGG + Intergenic
1019599474 7:1874079-1874101 GGCCACCGGGGATCCCGGGACGG + Intronic
1022468566 7:30667364-30667386 GGGCACCAGGGAGCCAGGGAGGG - Intronic
1023285776 7:38617589-38617611 TGGCACCTGGGCACCCAGCATGG - Intronic
1023319305 7:38976076-38976098 GGGCTCCCGGGCGCCCAGGAGGG + Intergenic
1024556386 7:50606442-50606464 GGGCCTCGGGGCTCCCGGGCCGG - Intronic
1024568750 7:50706887-50706909 GGCCAGCGGGCCACCAGGGATGG - Intronic
1024981507 7:55161214-55161236 AGGCACCCTGGCACCCGAGAGGG - Intronic
1025020074 7:55473614-55473636 GGGCACGGGGGCACCACAGAAGG + Intronic
1025929284 7:65981793-65981815 GGGAACAGGAGCACCCTGGAGGG - Intronic
1026899409 7:74028536-74028558 GGGCACCCGGGCACCTGAGCAGG - Intronic
1028753447 7:94408790-94408812 GGGCACCTGGGAAGCCTGGAGGG - Exonic
1029432417 7:100539634-100539656 GGGCTCCGGGGCGCGAGGGAAGG + Intronic
1032477698 7:132223636-132223658 AGGCACCTGGGCACAGGGGAAGG + Exonic
1034263969 7:149772727-149772749 GGGGACCGGGCCACTCGGTAGGG - Intronic
1036766625 8:11553652-11553674 GGGCACAGCTGCACCCGGGCAGG + Intronic
1039383375 8:37106922-37106944 GGGGCCCTGGGCACCTGGGAGGG + Intergenic
1041106943 8:54453738-54453760 GGACACCGCGGAACCAGGGAGGG + Intergenic
1041780261 8:61570539-61570561 GGGCCCTGGGGCACCAGAGAGGG - Intronic
1043533078 8:81171823-81171845 GGGCACCTAGGAACCCGGAAGGG - Intergenic
1047251037 8:123182378-123182400 GGGAATCGAGGCACCCAGGAGGG + Exonic
1049529934 8:143149086-143149108 GGACTCCCGGGCACCCAGGATGG + Intergenic
1049552446 8:143266911-143266933 GGGCGCTGGGGCCCCCGCGAGGG + Intronic
1049612641 8:143562572-143562594 GGGCCCTGTGGCACCTGGGAAGG + Intronic
1049646655 8:143738707-143738729 TGGGACCGGGGGAGCCGGGATGG - Intergenic
1057274188 9:93667585-93667607 GGGCCCAGGGGCACCATGGAGGG - Intronic
1057827494 9:98382172-98382194 GGGCAGAGTGGCCCCCGGGAAGG + Intronic
1059464400 9:114458604-114458626 GGGCCCTGGGGCACCCAGGGAGG - Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060997701 9:127884516-127884538 GGGCACTGGGCCAGCCAGGATGG - Intergenic
1061190761 9:129081294-129081316 GGGCGCCGGGGGACCGGGGTGGG + Intronic
1061615055 9:131774014-131774036 GGGCAGCCGGGCAGCCGGGCAGG + Intergenic
1062047740 9:134432204-134432226 GGGCACAGGGGGACCCAGCAAGG + Intronic
1062395568 9:136351303-136351325 GATCACCGGGACCCCCGGGAAGG - Intronic
1062402038 9:136376982-136377004 GGGCACCCTGGCACCAGGGGAGG + Intronic
1062499520 9:136846271-136846293 GGGCTCCGGGGCCCCCGCGCTGG + Exonic
1185507822 X:643028-643050 GGACACCTGGTGACCCGGGAGGG + Intronic
1185641795 X:1592525-1592547 GGTCAGTGGGGCACCAGGGAGGG - Intronic
1188123060 X:26334172-26334194 GGGCATCGCCTCACCCGGGAAGG + Intergenic
1190316722 X:49156422-49156444 GGGCGCTGGGGCACGCGGGCGGG + Intergenic
1191255143 X:58276435-58276457 GGGTGCGGGGGCTCCCGGGAAGG + Intergenic
1191255773 X:58278971-58278993 GGGCACGGGGGCTACCGGAAAGG + Intergenic
1191256233 X:58280791-58280813 GGGCACAGGGGCTGCCGGGAAGG + Intergenic
1192236870 X:69301665-69301687 GGGTACTGGGGGACCAGGGAGGG - Intergenic
1192533858 X:71911582-71911604 GGGCACGGGGCCACTCCGGACGG - Intergenic
1197767958 X:130071273-130071295 GGGCACCCTGGCAGCAGGGAAGG + Intronic
1199996975 X:153031639-153031661 GGGCCCTGGGGCCCTCGGGAAGG + Intergenic
1200256547 X:154585722-154585744 GGGCACCGGGTCATGCGGGGAGG + Intronic
1200261222 X:154618681-154618703 GGGCACCGGGTCATGCGGGGAGG - Intronic
1200775518 Y:7167006-7167028 GGGGAATGGGGCACCCAGGAAGG - Intergenic