ID: 1176088630

View in Genome Browser
Species Human (GRCh38)
Location 20:63309266-63309288
Sequence CCCACCGCAGGTGGCCCCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 110}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176088619_1176088630 11 Left 1176088619 20:63309232-63309254 CCTCTTTACTCCTGACCCAGTCT 0: 1
1: 0
2: 1
3: 22
4: 278
Right 1176088630 20:63309266-63309288 CCCACCGCAGGTGGCCCCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
1176088622_1176088630 -4 Left 1176088622 20:63309247-63309269 CCCAGTCTCCATGGAGACCCCCA 0: 1
1: 0
2: 1
3: 19
4: 233
Right 1176088630 20:63309266-63309288 CCCACCGCAGGTGGCCCCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
1176088617_1176088630 19 Left 1176088617 20:63309224-63309246 CCCATAGGCCTCTTTACTCCTGA 0: 1
1: 0
2: 0
3: 5
4: 126
Right 1176088630 20:63309266-63309288 CCCACCGCAGGTGGCCCCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
1176088621_1176088630 1 Left 1176088621 20:63309242-63309264 CCTGACCCAGTCTCCATGGAGAC 0: 1
1: 0
2: 3
3: 18
4: 195
Right 1176088630 20:63309266-63309288 CCCACCGCAGGTGGCCCCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
1176088618_1176088630 18 Left 1176088618 20:63309225-63309247 CCATAGGCCTCTTTACTCCTGAC 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1176088630 20:63309266-63309288 CCCACCGCAGGTGGCCCCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
1176088616_1176088630 29 Left 1176088616 20:63309214-63309236 CCGAGTACAGCCCATAGGCCTCT 0: 1
1: 1
2: 1
3: 10
4: 124
Right 1176088630 20:63309266-63309288 CCCACCGCAGGTGGCCCCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
1176088623_1176088630 -5 Left 1176088623 20:63309248-63309270 CCAGTCTCCATGGAGACCCCCAC 0: 1
1: 0
2: 4
3: 33
4: 269
Right 1176088630 20:63309266-63309288 CCCACCGCAGGTGGCCCCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176088630 Original CRISPR CCCACCGCAGGTGGCCCCGT CGG Intronic