ID: 1176088630

View in Genome Browser
Species Human (GRCh38)
Location 20:63309266-63309288
Sequence CCCACCGCAGGTGGCCCCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 110}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176088616_1176088630 29 Left 1176088616 20:63309214-63309236 CCGAGTACAGCCCATAGGCCTCT 0: 1
1: 1
2: 1
3: 10
4: 124
Right 1176088630 20:63309266-63309288 CCCACCGCAGGTGGCCCCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
1176088621_1176088630 1 Left 1176088621 20:63309242-63309264 CCTGACCCAGTCTCCATGGAGAC 0: 1
1: 0
2: 3
3: 18
4: 195
Right 1176088630 20:63309266-63309288 CCCACCGCAGGTGGCCCCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
1176088622_1176088630 -4 Left 1176088622 20:63309247-63309269 CCCAGTCTCCATGGAGACCCCCA 0: 1
1: 0
2: 1
3: 19
4: 233
Right 1176088630 20:63309266-63309288 CCCACCGCAGGTGGCCCCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
1176088618_1176088630 18 Left 1176088618 20:63309225-63309247 CCATAGGCCTCTTTACTCCTGAC 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1176088630 20:63309266-63309288 CCCACCGCAGGTGGCCCCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
1176088617_1176088630 19 Left 1176088617 20:63309224-63309246 CCCATAGGCCTCTTTACTCCTGA 0: 1
1: 0
2: 0
3: 5
4: 126
Right 1176088630 20:63309266-63309288 CCCACCGCAGGTGGCCCCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
1176088623_1176088630 -5 Left 1176088623 20:63309248-63309270 CCAGTCTCCATGGAGACCCCCAC 0: 1
1: 0
2: 4
3: 33
4: 269
Right 1176088630 20:63309266-63309288 CCCACCGCAGGTGGCCCCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
1176088619_1176088630 11 Left 1176088619 20:63309232-63309254 CCTCTTTACTCCTGACCCAGTCT 0: 1
1: 0
2: 1
3: 22
4: 278
Right 1176088630 20:63309266-63309288 CCCACCGCAGGTGGCCCCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176088630 Original CRISPR CCCACCGCAGGTGGCCCCGT CGG Intronic
900379477 1:2376717-2376739 CCCACCGCTGGTGTCCGGGTGGG + Intronic
901829489 1:11883427-11883449 CCCACCCCATGTGGCCCTGAGGG + Intergenic
912747117 1:112254080-112254102 CACAACACAGGTGGCCCCGTGGG + Intergenic
914683734 1:149959683-149959705 CCCACCACAGTTGGCTCCATTGG + Exonic
919739484 1:200973422-200973444 CCCAGAGCAGCTGGCCCCATCGG + Intronic
919797035 1:201327069-201327091 CCCACTGCAGCAGGCCCCATGGG - Intronic
922210225 1:223480744-223480766 CCCACAGGAGATGGCCCTGTGGG + Intergenic
922460821 1:225813294-225813316 CCCAGCCCAGCTGGCCCCCTGGG + Intronic
1065691021 10:28333904-28333926 GCCACCGCAGCCGGCCCCCTTGG - Intronic
1074761932 10:116673425-116673447 CCCTCTGCAGGTGTCCCCTTTGG - Exonic
1075083062 10:119396791-119396813 CCCACAGCAGGTGGCACAGGAGG + Intronic
1075496485 10:122923524-122923546 CCCACTGCTGGTGGCCACGGGGG + Intergenic
1076531066 10:131144906-131144928 GAGACCGCAGGTGGCCCAGTGGG + Intronic
1076737945 10:132467089-132467111 CCCACCCCAGCTGGCCCTGGAGG + Intergenic
1076995105 11:293948-293970 CCCACCACAAGGGGCCCAGTGGG - Intronic
1077316041 11:1919799-1919821 CCGCACGCAGGAGGCCCCGTCGG - Intronic
1078085338 11:8230286-8230308 CCCACCTCAGGTAGTCGCGTCGG + Exonic
1081804494 11:45883055-45883077 CCCAGCTCAGGTGGCCCTGAGGG + Exonic
1084319878 11:68367332-68367354 CCCACAGCAGGTGGCATAGTAGG + Intronic
1085037792 11:73310160-73310182 CCATCCGCAGGTGGCCCTGTGGG + Exonic
1090998887 11:131891636-131891658 CCCACCGCAGAGAGCCCTGTGGG - Intronic
1091240761 11:134050714-134050736 CCCACCCCGGGTGGCCGCGACGG - Intergenic
1096774389 12:53955314-53955336 CCGAGCGCAGGCGGCCCCGACGG - Exonic
1096897614 12:54839821-54839843 CCCACCACAGGTGACACAGTTGG - Intronic
1102953471 12:117045225-117045247 CCCACCTCATGGGGGCCCGTAGG + Intronic
1103120175 12:118373194-118373216 CGCACCCCAGGCGGGCCCGTAGG - Intergenic
1105504674 13:20999251-20999273 CCGACCGCTGGTGGCGCCGCAGG + Intronic
1105636059 13:22216366-22216388 GCCACCGCACCTGGCCCTGTCGG + Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1105863668 13:24439968-24439990 CCAGGCTCAGGTGGCCCCGTAGG - Intronic
1112328384 13:98459174-98459196 CCCATGGGAGTTGGCCCCGTGGG - Intronic
1122035655 14:98947382-98947404 CCCACCACACGTGGCCCTGGTGG + Intergenic
1123050069 14:105537097-105537119 CCCACACCAGGTGGCCAGGTGGG - Intergenic
1125462322 15:39919575-39919597 CCCTCCTCAGATGGCCCCGGCGG - Intronic
1128678267 15:69627637-69627659 TCCACCCCAGGTGGCCCCCCTGG - Intergenic
1129320274 15:74770882-74770904 CCCACGGTAGGGGGCCCTGTGGG + Intergenic
1131259688 15:90882022-90882044 CCCACCTCAGGTGGCCAGGTGGG - Exonic
1132631313 16:918992-919014 TCCAGCCCAGGAGGCCCCGTGGG - Intronic
1132649590 16:1014469-1014491 CCCACTGTAGGAGGCCCCCTCGG - Intergenic
1136878893 16:33886223-33886245 CTCACCCCAGGGGGCCCCCTGGG - Intergenic
1137533117 16:49296109-49296131 ACCACCGCAGGTAGCCCGCTGGG + Intergenic
1141052965 16:80789314-80789336 GCCACCGCACCTGGCCCCGCAGG - Intronic
1203093127 16_KI270728v1_random:1229166-1229188 CTCACCCCAGGGGGCCCCCTGGG + Intergenic
1144960709 17:19042558-19042580 CACACCACAGGTGGGCCCGGAGG + Intronic
1144974451 17:19131966-19131988 CACACCACAGGTGGGCCCGGAGG - Intronic
1146703323 17:34980823-34980845 CCCGCCTCACGCGGCCCCGTGGG - Intronic
1148075978 17:44935388-44935410 CCCAGCCCCGGTGGCCCCGTAGG + Exonic
1151752108 17:76045199-76045221 CCCACAGCAGATGGGACCGTTGG - Intronic
1152031446 17:77845913-77845935 CTGCCCGCAGGTGGCCCCCTGGG + Intergenic
1152352144 17:79790024-79790046 CCCTCTGCAGGTGGCGGCGTCGG - Intergenic
1157681980 18:49614448-49614470 GCCACCGCACCTGGCCCAGTCGG - Intergenic
1157873347 18:51249960-51249982 ACCACGGCAGCTGGCCCCTTGGG + Intergenic
1160196204 18:76757884-76757906 ACCACGGCAGGTGCCCCCGGTGG - Intergenic
1160413929 18:78694474-78694496 CCCAGAGCAGGTGGCCCTGCAGG - Intergenic
1160940634 19:1619003-1619025 CCCAGGGCAGGTGTCACCGTGGG - Intronic
1161323497 19:3652110-3652132 CCCAGCACGGATGGCCCCGTGGG + Intronic
1161397900 19:4054440-4054462 TCCGCCGCCGGTGGCCCCGCCGG - Exonic
1161535604 19:4817091-4817113 CTCGCAGAAGGTGGCCCCGTCGG + Exonic
1162940638 19:14006935-14006957 CCCACTGCCCATGGCCCCGTCGG + Intronic
1164694312 19:30232128-30232150 CCCACCCCAGGTGGGCCAGATGG - Intronic
1164746024 19:30614147-30614169 GCCACTGCACGTGGCCCTGTTGG + Intronic
1165069480 19:33247413-33247435 CCCACCACAGCTGGCCTCCTGGG - Intergenic
1166685573 19:44794194-44794216 CCCACCCCAGGTGCCCCTTTCGG + Exonic
1166702107 19:44888203-44888225 TCCACAGCAGGTGGCCCTGGAGG - Exonic
1167552130 19:50168551-50168573 CCCTCAGAAGGTGGCCCAGTTGG - Intergenic
1168097616 19:54124489-54124511 CCCACCGCAGGTGTGGCCGGCGG + Exonic
928192185 2:29181609-29181631 CCCACCGCAGGTGGCATTGAAGG + Exonic
937487028 2:122325906-122325928 CCCATCGCAGGTAGCTCTGTAGG + Intergenic
937910418 2:127073030-127073052 CCCACAGCAGGGGTCCCCATGGG + Intronic
1168819023 20:761226-761248 GGCCCCGCAGGTGGCCTCGTGGG - Exonic
1173966010 20:47113449-47113471 CCCACTGCAGGTGGCTTGGTGGG - Intronic
1176088630 20:63309266-63309288 CCCACCGCAGGTGGCCCCGTCGG + Intronic
1179602926 21:42492996-42493018 CCCTTCGTAGGTGTCCCCGTTGG + Exonic
1179784047 21:43719683-43719705 CCCGCGGCAGTTGGCCCGGTCGG - Intronic
1179791656 21:43759432-43759454 CCCGACACAGGTGGCCCCATCGG - Exonic
1180175218 21:46083955-46083977 CCCACCGCAGATGGCTCCTAGGG + Intergenic
1180851746 22:19025325-19025347 CCCAGCGCAGGTGGCTCTGCAGG - Intergenic
1182251794 22:29006496-29006518 GCCACCGCACCTGGCCCAGTTGG + Intronic
1182429723 22:30292485-30292507 CCCACAGCATGTGCCCCCGAAGG - Exonic
1184033435 22:41907716-41907738 CCCACCCCAGGTGACCCAGCTGG - Intergenic
1184099750 22:42335896-42335918 CCCACCACAGGTGGCCTCGGGGG - Intronic
1184276284 22:43411436-43411458 CCCACAGCAGGGTGCCCCGGCGG + Exonic
1184497938 22:44853739-44853761 ACCACCGCAGCTGGCCCTGATGG - Intronic
950126849 3:10514864-10514886 CCCCCTGCAGGTGGCCCCAGGGG + Intronic
953392788 3:42543554-42543576 CCCAACACAGGTGGCCTCCTGGG + Intergenic
955433248 3:58871812-58871834 GCCACCGCACCTGGCCCCATAGG + Intronic
968249776 3:197198201-197198223 GCCACCGCACCTGGCCCCTTTGG - Intronic
968517823 4:1022231-1022253 CCCACGGCAGGTGGCCCGGCTGG + Exonic
968911567 4:3479166-3479188 CCAGCCGCTGGTGGCCCCGGCGG + Intronic
968921434 4:3524115-3524137 CGCACACCAGGTGGGCCCGTGGG - Intronic
969714052 4:8860024-8860046 AGCACCGCCGTTGGCCCCGTCGG - Intronic
971052433 4:22876322-22876344 CCCACAGCAGCTGGCGCAGTGGG - Intergenic
985777292 5:1851466-1851488 CCCACCACACCTGGCCCCCTGGG + Intergenic
996765546 5:127031177-127031199 CCCGCTGCAGGTGGCCCGGAGGG - Intergenic
999228992 5:150050444-150050466 CTCACCACAGGTGGCTCTGTGGG - Exonic
1001618968 5:173065920-173065942 CCAACCGCACCTGGCCCCTTTGG + Intronic
1001623167 5:173106141-173106163 GCCACCGCACCTGGCCCCTTAGG - Intronic
1002681784 5:180970464-180970486 CCCACCGCCGGTGCCCGAGTGGG + Intergenic
1021665193 7:22969808-22969830 GCCACCGCATCTGGCCCCTTCGG + Intronic
1023703009 7:42911639-42911661 CCCAGCGCAGGTCGCCGGGTGGG + Intronic
1024270862 7:47640385-47640407 CCCACCTCAGCTGGCGCTGTGGG - Intergenic
1036910898 8:12755810-12755832 GCCACCGCAGGTGGCGGCGTTGG - Intronic
1037300141 8:17443105-17443127 GCCACCGCACCTGGCCCCCTGGG - Intergenic
1041696463 8:60741936-60741958 GCCACCGCAGCCGGCTCCGTCGG + Exonic
1042738529 8:72016659-72016681 CTCACCCCAGGAGGCCACGTGGG - Intronic
1049180647 8:141220422-141220444 CCCACTGCAGGAGGACTCGTAGG - Intronic
1049710366 8:144060521-144060543 CCCGCCTCGGGTCGCCCCGTCGG - Intronic
1049806967 8:144545462-144545484 CCCACTGCACGTGGCCCTGGAGG - Exonic
1060994266 9:127867418-127867440 CCCACGCCAGCTGGCCCAGTGGG - Exonic
1062218903 9:135403881-135403903 CCTACCCCAGGTGGCACCTTGGG - Intergenic
1062291345 9:135796589-135796611 CCCACGGCAGGTGGCACAGCTGG + Intergenic
1203782043 EBV:106064-106086 ACCACGGCCGGTGGCCCCGTCGG + Intergenic
1203782839 EBV:110461-110483 CCCTCGGCGTGTGGCCCCGTGGG - Intergenic
1188335367 X:28925638-28925660 GCCACCGCACCTGGCCCCTTTGG - Intronic
1191762903 X:64663749-64663771 CCCACCACTGGTGGCCAAGTGGG + Intergenic
1192630920 X:72777338-72777360 CCCGCTGCAGGCGCCCCCGTGGG - Intronic
1192650789 X:72943463-72943485 CCCGCTGCAGGCGCCCCCGTGGG + Intronic
1195636206 X:107118545-107118567 CCCACAGCAGCCGGCCCCGGTGG + Intronic
1201284496 Y:12367752-12367774 GCCACCGCACCTGGCCCCCTGGG - Intergenic