ID: 1176091666

View in Genome Browser
Species Human (GRCh38)
Location 20:63321085-63321107
Sequence GGACTCACTGGGGGTCCTTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 1, 2: 3, 3: 13, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176091666_1176091676 3 Left 1176091666 20:63321085-63321107 CCTCAAGGACCCCCAGTGAGTCC 0: 1
1: 1
2: 3
3: 13
4: 160
Right 1176091676 20:63321111-63321133 GGCGTCTCCTTGGGGTGACCAGG 0: 1
1: 0
2: 0
3: 8
4: 161
1176091666_1176091673 -6 Left 1176091666 20:63321085-63321107 CCTCAAGGACCCCCAGTGAGTCC 0: 1
1: 1
2: 3
3: 13
4: 160
Right 1176091673 20:63321102-63321124 GAGTCCAGTGGCGTCTCCTTGGG 0: 1
1: 0
2: 1
3: 7
4: 207
1176091666_1176091672 -7 Left 1176091666 20:63321085-63321107 CCTCAAGGACCCCCAGTGAGTCC 0: 1
1: 1
2: 3
3: 13
4: 160
Right 1176091672 20:63321101-63321123 TGAGTCCAGTGGCGTCTCCTTGG 0: 1
1: 0
2: 2
3: 36
4: 1386
1176091666_1176091674 -5 Left 1176091666 20:63321085-63321107 CCTCAAGGACCCCCAGTGAGTCC 0: 1
1: 1
2: 3
3: 13
4: 160
Right 1176091674 20:63321103-63321125 AGTCCAGTGGCGTCTCCTTGGGG 0: 1
1: 0
2: 2
3: 13
4: 175
1176091666_1176091679 12 Left 1176091666 20:63321085-63321107 CCTCAAGGACCCCCAGTGAGTCC 0: 1
1: 1
2: 3
3: 13
4: 160
Right 1176091679 20:63321120-63321142 TTGGGGTGACCAGGGAACACTGG 0: 1
1: 0
2: 6
3: 14
4: 165
1176091666_1176091677 4 Left 1176091666 20:63321085-63321107 CCTCAAGGACCCCCAGTGAGTCC 0: 1
1: 1
2: 3
3: 13
4: 160
Right 1176091677 20:63321112-63321134 GCGTCTCCTTGGGGTGACCAGGG 0: 1
1: 0
2: 1
3: 6
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176091666 Original CRISPR GGACTCACTGGGGGTCCTTG AGG (reversed) Exonic
900116969 1:1033119-1033141 GGACTCCCTGCGGGTCCGTGGGG - Intronic
900592484 1:3466242-3466264 GGTCTCACTGGGGCACCCTGGGG + Intronic
902242747 1:15099746-15099768 GGACCCCCTGGTGGTCCTGGGGG + Intronic
903947213 1:26971446-26971468 GGACTCAGTGAGTGACCTTGGGG + Intergenic
904828991 1:33294800-33294822 GGGCTCACTCTTGGTCCTTGGGG + Intronic
907526844 1:55058730-55058752 GGGCTTGCTGGGGGTCCCTGAGG - Intronic
909490355 1:76219521-76219543 GGAGTCTGAGGGGGTCCTTGAGG + Intronic
913442111 1:118909130-118909152 GGACTCACTGGGGCTCCCCTTGG + Intronic
913524253 1:119676082-119676104 GGGCTCCCTGTGTGTCCTTGGGG - Intronic
915142543 1:153776348-153776370 CGACTCCTTGGGGATCCTTGGGG - Intronic
915510098 1:156382145-156382167 GGCCCTCCTGGGGGTCCTTGTGG + Exonic
917581586 1:176383949-176383971 GGGATCACTGGGGGTCATTTTGG + Intergenic
917724480 1:177815798-177815820 GGGCTCATGAGGGGTCCTTGAGG + Intergenic
918136540 1:181679319-181679341 TTACTAACTGGGGATCCTTGGGG - Intronic
921222088 1:212980518-212980540 GGACACCCTGGGGGTCCCAGAGG + Intronic
923715693 1:236423105-236423127 GAAATCTCTGGGGGTCCTAGTGG + Intronic
924477626 1:244395566-244395588 GGAGTCAGTGGAGATCCTTGGGG - Intergenic
1064347751 10:14548295-14548317 GGACACCCTGGGGGTCCAGGGGG + Intronic
1069814759 10:71186720-71186742 TGAGCCACTGGGGGTCCTTCTGG + Intergenic
1073262558 10:102201343-102201365 GGCCTCACTGGCCGTGCTTGAGG - Intergenic
1075225388 10:120624413-120624435 TGACCCAGTAGGGGTCCTTGGGG + Intergenic
1075608501 10:123833448-123833470 GGAGGCACTGGGGGTGCTGGAGG + Intronic
1076036275 10:127201146-127201168 GGCCCCACTGGGGCACCTTGAGG - Intronic
1076237848 10:128879641-128879663 GGACACTCTAGGGGTCCATGGGG + Intergenic
1076338681 10:129728027-129728049 GGTCTCACTGGGGGACAGTGAGG + Intronic
1076582362 10:131520266-131520288 GGAGTCCCAGAGGGTCCTTGGGG + Intergenic
1078082844 11:8216848-8216870 GGACTCATTGGAGCTCTTTGTGG - Intergenic
1078340270 11:10493522-10493544 GGACTCACTGGATGTCCACGCGG + Exonic
1078563491 11:12393611-12393633 GGACTCAGTGGGAGGTCTTGGGG + Intronic
1083737462 11:64689866-64689888 GCACCCACTGGAGTTCCTTGAGG + Intronic
1085593881 11:77790767-77790789 GGAGTCACTGGAGGTCATTTTGG - Intronic
1088834904 11:113569249-113569271 GGACACTCTGTGGGTCCTTGGGG - Intergenic
1089248091 11:117137243-117137265 GGCCTCACTGGGTGCCCTTAGGG - Intergenic
1089258622 11:117207318-117207340 GGCCTCACTGGGTGCCCTTAGGG + Intronic
1089560933 11:119342772-119342794 GGACACTCTGGGGGTACTGGGGG - Intronic
1089576707 11:119449534-119449556 GAACACACTAGGTGTCCTTGAGG - Intergenic
1089696515 11:120219247-120219269 GGAGCCACTGGGAGACCTTGCGG + Intronic
1092011121 12:5113440-5113462 GGACTCAGTGAGTGCCCTTGGGG + Intergenic
1092147250 12:6223204-6223226 GGACTGACTGGGCCTCCCTGGGG + Intronic
1093835956 12:23828998-23829020 GGGTACACTGGGAGTCCTTGAGG + Intronic
1097690982 12:62734470-62734492 GGAGTCACTGAAGTTCCTTGTGG + Intronic
1100871528 12:98915066-98915088 GGACTTACTGGGGGTGGTGGGGG - Intronic
1102726107 12:115066433-115066455 GGGCAGACTGGGGGTCCTTGGGG + Intergenic
1103258348 12:119562855-119562877 GGCATTTCTGGGGGTCCTTGAGG - Intergenic
1103639044 12:122333617-122333639 GGAGTCACTGGATGACCTTGAGG + Intronic
1104936659 12:132368063-132368085 GGGGTCACTGGGGGTCGCTGGGG - Intergenic
1105893613 13:24699696-24699718 GGACCCAATGGGGGTGCCTGCGG + Intronic
1110527191 13:76552069-76552091 ATACTCACTGGAGGTGCTTGTGG + Intergenic
1113399706 13:109979557-109979579 GGATGCACTGTGGGTCCTGGGGG + Intergenic
1113507074 13:110824384-110824406 ATACTCACTGGTGGTGCTTGTGG + Intergenic
1113811748 13:113146901-113146923 TGACTTCCTGGGGGTCCCTGTGG - Intronic
1118411016 14:65478241-65478263 GTATCCACTGGGGGGCCTTGGGG - Intronic
1120930387 14:89842225-89842247 AGACCCACTAGGGGTCATTGTGG - Intronic
1121511110 14:94514270-94514292 GGACACACTGGTGGCCCTTTGGG - Intronic
1121839690 14:97122742-97122764 GGACTCTCTGGAGCTCCTTGAGG + Intergenic
1122320845 14:100854847-100854869 GGCCTCAGTGGTGGTCTTTGGGG + Intergenic
1122518809 14:102327915-102327937 GGAGTCCCTGGGGGTGCTTCTGG + Intronic
1122972776 14:105159113-105159135 GGACTGGGTGGGGGTCCTGGAGG - Intronic
1129537458 15:76325724-76325746 TGACTCACTGGGGGTCACTTCGG - Intergenic
1129693829 15:77729337-77729359 GGAGACACTGAGGGTCCTTGAGG + Intronic
1130938331 15:88488463-88488485 GGACACACAGGGGATCCTGGTGG + Intergenic
1132114314 15:99124645-99124667 GGCCTCACTGGGAGGCCTAGTGG + Intronic
1133022228 16:2971753-2971775 GGACGCACTGGCGCTGCTTGGGG + Exonic
1133469011 16:6056024-6056046 GCACTCAATGAGGGTTCTTGGGG + Intronic
1138475656 16:57269337-57269359 GGGCTCACTGTGTGGCCTTGGGG + Intronic
1140877163 16:79163323-79163345 GTACTAACTGGGGGGTCTTGAGG + Intronic
1142310414 16:89309168-89309190 GGATTCCCTGGTGGTTCTTGGGG + Intronic
1142589000 17:992954-992976 GGGCTTACTGGAGGTCCGTGAGG - Intergenic
1146695350 17:34904928-34904950 GGACTCTCTGGAGGCCCCTGGGG - Intergenic
1147605319 17:41770895-41770917 GGAATCCCTGGGGGTTCCTGGGG + Intronic
1149538266 17:57449197-57449219 GTACTCACTGAGCCTCCTTGAGG + Intronic
1150055471 17:62010904-62010926 GGACTAAGTGGGGGTGGTTGAGG + Exonic
1155059208 18:22213584-22213606 GGCCTCTCTGAGGGTTCTTGGGG + Intergenic
1161014391 19:1976488-1976510 GGAATCGCTGGGGCTCCTTCTGG - Intronic
1161031065 19:2057975-2057997 GTGCTCACTGGGTGTCCATGGGG - Intergenic
1161569664 19:5023589-5023611 GGACTCACTGGGGCCGCATGGGG + Intronic
1161710477 19:5844687-5844709 GGACCCACTGGGAGCCCTAGGGG + Exonic
1162019105 19:7860635-7860657 GGAGACACTGGGGGCCCTTCGGG + Exonic
1162320270 19:9967339-9967361 GAACTCACCGGGGGGCCTGGTGG + Exonic
1163195594 19:15717487-15717509 GAGCTCACTGGGGGTGCTTCTGG + Intergenic
1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG + Intronic
1163584211 19:18155344-18155366 TGAATCACTGGGTGACCTTGGGG - Intronic
1164818797 19:31227964-31227986 GGACTTGTTGGGGGTCCGTGTGG - Intergenic
1165071823 19:33260408-33260430 GGACTCACTGTGGGTGTTTGGGG - Intergenic
1165364386 19:35355947-35355969 GGAGGCACTGGGGCTCCCTGGGG - Intergenic
1166459748 19:42975868-42975890 GGCCTAACTGGCTGTCCTTGTGG - Intronic
1168719562 19:58547497-58547519 GGACTCACTGGTGGTCCTTGTGG - Exonic
925208208 2:2025272-2025294 GGACTCACTCCGGGAGCTTGAGG - Intronic
926284893 2:11481498-11481520 GGCCCCACTGTGGGTCCTGGGGG + Intergenic
928171165 2:29003737-29003759 AGATCCACTGGGGCTCCTTGTGG + Intronic
929305295 2:40354457-40354479 GGACTAAATGGGGGTGGTTGTGG + Intronic
932735845 2:74254061-74254083 ATACTCACTGGCGGTGCTTGCGG - Intronic
934300193 2:91772285-91772307 GGGCTCACTGGAGGGGCTTGTGG + Intergenic
936072917 2:109383300-109383322 GGAGTCACTGGGGGGTCATGGGG + Intronic
940029143 2:149241934-149241956 GGACTCAGTGGGGATGGTTGGGG + Intergenic
940485561 2:154291490-154291512 GCACTCGCTGGGGGACTTTGCGG + Intronic
948206352 2:236164595-236164617 GGACTACCGGGGCGTCCTTGGGG + Intergenic
948351945 2:237347915-237347937 GATCTCACTGAGGGTCCGTGGGG + Intronic
948387794 2:237592461-237592483 GGACTGGCTTGGGGTCTTTGAGG - Intronic
948983167 2:241505342-241505364 GGACTCCCTTGGGGTCTTTCCGG - Intronic
949017088 2:241719633-241719655 GCAGGCACTGGGGGTCCTCGTGG + Intronic
1168824814 20:802965-802987 CGAGTGACTGGGGGGCCTTGCGG + Intergenic
1171516935 20:25745741-25745763 GGACTCACTGGAGGTAGTGGGGG + Intergenic
1172182152 20:33010071-33010093 AGACTCACTGTGGGAACTTGAGG - Intronic
1172671055 20:36634690-36634712 GGACTCCCTCAGGGTGCTTGTGG - Intronic
1173176972 20:40771864-40771886 GGACTGGTTGGGGGTCCTGGAGG - Intergenic
1173555456 20:43962309-43962331 GGACTCACTGGTGGTCCTGGGGG + Intronic
1175315511 20:58044124-58044146 GGAAGGACTGGGGCTCCTTGTGG - Intergenic
1176091666 20:63321085-63321107 GGACTCACTGGGGGTCCTTGAGG - Exonic
1176117594 20:63439832-63439854 GGCCTCACTGGGCCTCCGTGTGG - Intronic
1179828459 21:43981570-43981592 GAAGTCACTGGGGGTCAATGGGG - Intronic
1180079023 21:45477906-45477928 GGAGGCCCTGGGGGTCCTTGTGG - Exonic
1181544275 22:23592188-23592210 GGACTCAATGGGGGTGTCTGAGG + Intergenic
1182283738 22:29232258-29232280 GGGCTCCCTGGGGGGCCCTGTGG - Exonic
1182393666 22:30020017-30020039 GGATTCCCTGGAGGTCCCTGTGG + Exonic
1182936350 22:34225913-34225935 TGACCCACTTGGGGCCCTTGAGG + Intergenic
1185198678 22:49489306-49489328 GGCCTCACTGGGGGGACTGGCGG + Intronic
950406214 3:12806714-12806736 GGAATCACCTGGGGACCTTGTGG + Intronic
951520803 3:23609287-23609309 GGAGTCACTGGGGGGCCTCTGGG - Intergenic
953879208 3:46683076-46683098 GGACTCCCTGGGGGTCTGCGGGG - Intronic
954591951 3:51790404-51790426 GTAATCACTGAGGGTCCTTGAGG + Intergenic
955291615 3:57697423-57697445 GGACTCCCTGTGGGTCCTTTTGG - Intergenic
958627641 3:96646592-96646614 GCACTCACTGTGGGACTTTGGGG + Intergenic
959846756 3:111041531-111041553 GGACTCACAGGGGGTCCATGTGG - Intergenic
960844484 3:121993705-121993727 GGAGTCACTGGTCCTCCTTGAGG + Exonic
962285846 3:134085015-134085037 GGACTCACAGGGGCTCCTCCTGG - Intronic
964893832 3:161569835-161569857 GGACTCACTGGGAGACTTAGCGG + Intergenic
965139260 3:164814421-164814443 GCACTCACTGCGGGACTTTGTGG - Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968666756 4:1826613-1826635 GGACCCACTGGGGGTGCTATGGG + Intronic
968761032 4:2442877-2442899 GAGCTCACTGGGGGTGCTGGGGG + Intronic
968761060 4:2442943-2442965 GGAGCCACTGGGGGTGCTGGGGG + Intronic
968761089 4:2443009-2443031 GGAGCCACTGGGGGTGCTGGGGG + Intronic
969286588 4:6206256-6206278 GGAGCCACTGGGGGCTCTTGGGG + Intergenic
970124994 4:12799281-12799303 GGAATCACTGGGGTTACCTGTGG - Intergenic
970596774 4:17607537-17607559 GAACTCAATGAGAGTCCTTGTGG - Exonic
975613130 4:76221012-76221034 GGAATCAGTGAGGGACCTTGGGG - Intronic
975955239 4:79829047-79829069 ATACTCACTGGTGGTGCTTGTGG + Intergenic
976214697 4:82705147-82705169 GGACAGACTGGGCGTGCTTGGGG + Intronic
977044478 4:92051603-92051625 GGACTCACTGGGGGGCTTGGGGG + Intergenic
980694247 4:136336201-136336223 GGACACACTGGGATTCATTGAGG + Intergenic
982723791 4:158884521-158884543 GGACTCACGCCAGGTCCTTGAGG + Intronic
986229103 5:5845198-5845220 ACACTCCCTGGGGGTCCTTCTGG + Intergenic
987100206 5:14584326-14584348 GGACTCATTGGAGGTTCTTAGGG + Intronic
988605909 5:32678357-32678379 GCACTCACTGGTGGACTTTGTGG + Intergenic
998527997 5:142860071-142860093 GGGCGCACTGGGGCTCCTTGTGG - Intronic
1000217879 5:159181262-159181284 GGATTCACTGGGGGACCATTTGG - Intronic
1002570387 5:180136569-180136591 AGCCTCACTGCGCGTCCTTGCGG + Intronic
1013177856 6:107692702-107692724 GGACTCACTGGGGCTCTGTGGGG - Intergenic
1015559969 6:134503652-134503674 GGACTCAATCAGGGTCCTAGAGG - Intergenic
1017960825 6:159218974-159218996 GCACTGACTGGGGGTTCCTGGGG + Intronic
1018704010 6:166450145-166450167 GGTCTCCCTGGTGGTCCCTGTGG - Intronic
1018721014 6:166572717-166572739 CCCCTCACTGAGGGTCCTTGGGG + Intronic
1022131847 7:27411894-27411916 GGACTCTCTGGAGGGCTTTGAGG - Intergenic
1022494231 7:30843285-30843307 GGAGTCACTGGGGGTGGTTAGGG + Intronic
1025102083 7:56143834-56143856 GGACACATTGGGGTTCCTGGAGG + Intergenic
1031624713 7:123978923-123978945 GGACTTTCTGGGAGACCTTGAGG - Intergenic
1037363231 8:18095928-18095950 GGAGTCACTGGGGGGATTTGGGG - Intergenic
1043183853 8:77119996-77120018 AGAATCACTGCAGGTCCTTGTGG - Intergenic
1049418257 8:142505359-142505381 GGACTCAGTGGAGGTGCCTGTGG + Intronic
1051711370 9:19934453-19934475 GGATTTGCTTGGGGTCCTTGTGG - Intergenic
1052318135 9:27137876-27137898 GGTCTCACTGTGGACCCTTGCGG + Intronic
1052975794 9:34409017-34409039 GGACTCACATGTGGTCCTTGAGG + Intronic
1057916077 9:99056287-99056309 GGAGCACCTGGGGGTCCTTGGGG - Exonic
1059451104 9:114371980-114372002 GGATTCACTCTGGGTCCATGGGG - Intronic
1059983966 9:119803542-119803564 GGAGTCACTGTGCCTCCTTGAGG + Intergenic
1060045452 9:120336811-120336833 GGCCTCAGTGGGGTTCCATGTGG + Intergenic
1060149855 9:121281670-121281692 GGATTCAGTGGGAGTCCCTGAGG + Intronic
1061031692 9:128088377-128088399 TGACTCCCTGGGGACCCTTGGGG + Intronic
1061825945 9:133258260-133258282 GGAATCACTGTGGTTGCTTGGGG + Intronic
1062120677 9:134832517-134832539 GGCCTCACTGTGGGACCCTGGGG + Intronic
1062605756 9:137348229-137348251 GGCCTCACTGCAGGTCCCTGTGG - Exonic
1191899173 X:66023185-66023207 GGACTCTCTGGGGATCCTTGGGG - Intronic
1192312419 X:70027916-70027938 GGAATTCCTGGGGGTCCCTGGGG - Exonic
1193590537 X:83384100-83384122 GGACTCCCTGGGCTTTCTTGGGG - Intergenic
1195793331 X:108614982-108615004 GGAATCCCTGGTGGTCCTGGTGG - Exonic
1200066941 X:153508467-153508489 GGCCTCAGTGGGGGTCTCTGGGG + Exonic
1201961046 Y:19681160-19681182 GGTCACACTGGGGGACATTGGGG + Intergenic