ID: 1176096605

View in Genome Browser
Species Human (GRCh38)
Location 20:63347230-63347252
Sequence GCTGAGAGCAGACCGCTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 155}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176096605_1176096607 -10 Left 1176096605 20:63347230-63347252 CCCGTGAGCGGTCTGCTCTCAGC 0: 1
1: 0
2: 1
3: 15
4: 155
Right 1176096607 20:63347243-63347265 TGCTCTCAGCTCACCAGCGCTGG 0: 1
1: 0
2: 2
3: 5
4: 150
1176096605_1176096617 24 Left 1176096605 20:63347230-63347252 CCCGTGAGCGGTCTGCTCTCAGC 0: 1
1: 0
2: 1
3: 15
4: 155
Right 1176096617 20:63347277-63347299 CCCCTCCCCGTTTTGCAGATGGG 0: 1
1: 1
2: 0
3: 23
4: 199
1176096605_1176096615 23 Left 1176096605 20:63347230-63347252 CCCGTGAGCGGTCTGCTCTCAGC 0: 1
1: 0
2: 1
3: 15
4: 155
Right 1176096615 20:63347276-63347298 CCCCCTCCCCGTTTTGCAGATGG 0: 1
1: 0
2: 4
3: 30
4: 320
1176096605_1176096609 -6 Left 1176096605 20:63347230-63347252 CCCGTGAGCGGTCTGCTCTCAGC 0: 1
1: 0
2: 1
3: 15
4: 155
Right 1176096609 20:63347247-63347269 CTCAGCTCACCAGCGCTGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 165
1176096605_1176096610 -5 Left 1176096605 20:63347230-63347252 CCCGTGAGCGGTCTGCTCTCAGC 0: 1
1: 0
2: 1
3: 15
4: 155
Right 1176096610 20:63347248-63347270 TCAGCTCACCAGCGCTGGGAGGG 0: 1
1: 0
2: 1
3: 12
4: 158
1176096605_1176096608 -9 Left 1176096605 20:63347230-63347252 CCCGTGAGCGGTCTGCTCTCAGC 0: 1
1: 0
2: 1
3: 15
4: 155
Right 1176096608 20:63347244-63347266 GCTCTCAGCTCACCAGCGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176096605 Original CRISPR GCTGAGAGCAGACCGCTCAC GGG (reversed) Intronic
900705369 1:4076937-4076959 GCTGAGACAAGACCGCTCCTCGG - Intergenic
901041658 1:6367939-6367961 GCTGAGAGCTGAACACTCACTGG - Intronic
902984713 1:20148526-20148548 TCTGAGAGCTGAGCCCTCACTGG - Exonic
904713098 1:32446489-32446511 GCTGAGTGCAAACAGCTCCCAGG + Intergenic
906205634 1:43985053-43985075 GCTGAGAAGAGAGCCCTCACCGG - Exonic
906448211 1:45922033-45922055 GCTGAGAGCTGAACACTCAACGG - Intronic
907335947 1:53699730-53699752 GCTGGGAAGAGACCTCTCACCGG - Intronic
907871435 1:58447066-58447088 GCTGAGAGCTGAGTGCTCAGTGG + Intronic
909639885 1:77861267-77861289 TTTTAGAGCAGACCGATCACTGG + Exonic
909750201 1:79150012-79150034 GGTGATAGCAGTCTGCTCACAGG - Intergenic
911043550 1:93610284-93610306 GCTCAGAGCAGAAGGTTCACTGG - Intronic
912821561 1:112871803-112871825 GCTGGAAGGAGACAGCTCACAGG + Intergenic
915545516 1:156595093-156595115 GCAGAGAGCAGAGCACACACTGG - Intronic
922287493 1:224183098-224183120 GCTGAGAGCCGGCCCCGCACGGG + Intronic
923104344 1:230843075-230843097 TCTGATAGCAGCCCGCGCACTGG + Intronic
1067267946 10:44763412-44763434 CCTGAGAGCACACCTCTTACAGG + Intergenic
1068474464 10:57507432-57507454 GCTGAGAGCTGGACGCTCATCGG + Intergenic
1070554093 10:77514784-77514806 GCTGAGCACAGAGCGCCCACAGG - Intronic
1071062581 10:81590321-81590343 GCTAACAGCAGACCTCTCATTGG + Intergenic
1072335503 10:94394939-94394961 GCTGAGAGCTGAACACTCAATGG - Intergenic
1072421742 10:95295397-95295419 GCCGAGCGCAGATCGCGCACCGG + Intergenic
1074247917 10:111713555-111713577 GCTGAGAGCTGTACACTCACTGG - Intergenic
1075949480 10:126464428-126464450 GCTGAGAGAAGACCACACCCAGG - Intronic
1076336425 10:129709813-129709835 CCTGAGAGCACACCACTCTCTGG - Intronic
1076579371 10:131496384-131496406 GCAGAGAGCAGGCCCCTCAGCGG + Intergenic
1078890107 11:15547889-15547911 GCTGAGAGGAGAGCCCTCCCCGG - Intergenic
1080892792 11:36423966-36423988 GCTGAGAGGTGACCTCTGACAGG - Intronic
1084469450 11:69348541-69348563 GCTGAGAGCTGAACACTCAAGGG - Intronic
1084643198 11:70438046-70438068 GCTGAGAGCAAGCTGCTCCCAGG - Intergenic
1084835790 11:71801052-71801074 GCTGAGAGGAGGGTGCTCACAGG - Exonic
1084908889 11:72371475-72371497 GCTGAGATCATGCCACTCACTGG + Intronic
1085808276 11:79657012-79657034 GCTGATATCACACAGCTCACAGG - Intergenic
1087338880 11:96877996-96878018 GCTGAGAGCTGAACACTCATTGG - Intergenic
1087640187 11:100748254-100748276 GCTGAGTGCAAACAGCTCGCAGG + Intronic
1087782214 11:102313109-102313131 ATTGAGAGCATACCGCTCTCAGG + Intergenic
1088651177 11:111958971-111958993 GCTGAGAGCTGAACACTCATCGG + Intronic
1089624493 11:119742551-119742573 GGGGAGAGGAGACCGCACACTGG - Intergenic
1090777747 11:129980064-129980086 GCTGAGATCAGAGCCCTCACAGG + Intronic
1092469663 12:8766557-8766579 GCTGAGTGCAAACAGCTCGCAGG + Intronic
1095727543 12:45469768-45469790 GCTGAGAGCTGAACACTCAAGGG + Intergenic
1097111654 12:56663162-56663184 GCTGAGCTCAGAGAGCTCACAGG - Intergenic
1097331790 12:58339383-58339405 GCTGAGGGAAGGCCGCTCTCAGG - Intergenic
1098802955 12:74985298-74985320 GCTGAGAGCTGAACACTCATCGG - Intergenic
1098951631 12:76645617-76645639 GCTAAGAGCTGAACACTCACTGG + Intergenic
1100976070 12:100123900-100123922 TCTGTGGGCAGACAGCTCACAGG - Intronic
1104805578 12:131587212-131587234 GCTGATAGCTGAACACTCACTGG + Intergenic
1107853508 13:44592436-44592458 GCTGAGAGCTGAACACTCAATGG + Intergenic
1109029976 13:57179258-57179280 GCTGAGAGCTGAACACTCACTGG - Intergenic
1109562813 13:64075637-64075659 GCTGAGAGCTGAACACTCACTGG - Intergenic
1113578563 13:111411903-111411925 GCTGCCTGCAGACAGCTCACTGG + Intergenic
1113650580 13:112031634-112031656 GGTGAGAGCAGAAGGCTCGCGGG - Intergenic
1113747769 13:112756808-112756830 GCTGGGAGCAGACCCCTCGCTGG - Intronic
1113747780 13:112756844-112756866 GCTGGGAGCAGACCCCGCGCTGG - Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1116221652 14:42095805-42095827 GCTGAGAGCTGAACACTCAATGG - Intergenic
1119036243 14:71232188-71232210 GCTGAGAGCTGAACACTCATCGG + Intergenic
1120877212 14:89386099-89386121 GCTGACAGCAAACAGCTCAGAGG + Intronic
1121695300 14:95907681-95907703 GCTGAGAGCTGTACGCTCAATGG - Intergenic
1122872256 14:104644400-104644422 GCCGAAAGCAGACCTCTCCCCGG + Intergenic
1126185681 15:45829053-45829075 GCTAAGAGCTGAACGCTCAACGG - Intergenic
1132221285 15:100107491-100107513 GCTGAGGGCAGAGCGCTCCCTGG + Intronic
1132883547 16:2172657-2172679 GCTGAGAGCTGCCCGCTTGCTGG + Intronic
1134328444 16:13228504-13228526 GCTCAGAGCAGACCTCAGACTGG + Intronic
1136345582 16:29673499-29673521 GCTGAGGGCTCACAGCTCACAGG - Intronic
1139389973 16:66601366-66601388 GCTGAGAGCTGAACACTCAACGG - Intergenic
1141555222 16:84832726-84832748 GCTGGGAGCTGACGGCTGACAGG + Intronic
1141837127 16:86548920-86548942 GCTGAGAGCAGAGGGGGCACAGG - Intronic
1142302146 16:89265098-89265120 GCGGGGAGCTGACGGCTCACGGG + Intergenic
1142894000 17:2963034-2963056 GCTGAGAGCTGACTGCCCACTGG - Intronic
1142928307 17:3260185-3260207 TCTGAGAGCAGAACGGACACTGG + Intergenic
1142964288 17:3571302-3571324 GCTGATGGCTGACGGCTCACTGG - Intronic
1144063088 17:11600370-11600392 ACTGAGAGCAGACTGATCAAAGG + Intronic
1146303506 17:31710335-31710357 GCTGACAGCAGACTTCTCAACGG + Intergenic
1147627208 17:41907937-41907959 GCTGACAGAAGACCCCCCACCGG + Intronic
1148093839 17:45039023-45039045 TCTGAGAACAGAGCGCTGACAGG + Intronic
1149444353 17:56702057-56702079 TCTGAGAGGAGACTCCTCACAGG - Intergenic
1150521081 17:65866713-65866735 GCTGAGAGCTGAACACTCATTGG + Intronic
1151395253 17:73819089-73819111 GCTGAGAGCCGAACACTCAATGG - Intergenic
1152076711 17:78164475-78164497 GCTGAGAGCAGAGAGGGCACAGG + Intronic
1152588168 17:81198340-81198362 GCTGAGAGCAGCCCCCACATAGG + Intronic
1152610786 17:81314161-81314183 GCTGGGAGCAGAGCCCCCACAGG - Intronic
1153108820 18:1560017-1560039 GCTCAGAGCAGACAGCTCTATGG + Intergenic
1157331300 18:46705649-46705671 GCTGTGAGGAGAGGGCTCACCGG - Intronic
1157546876 18:48552870-48552892 CCTGAGAGCAGCCAGATCACAGG - Intronic
1158139416 18:54241502-54241524 ACTGAGAGCTGAGCACTCACAGG - Intergenic
1158139422 18:54241559-54241581 GCTGAGAGCTGAACACTCATTGG - Intergenic
1159334859 18:67048779-67048801 GCTGGCATCATACCGCTCACAGG - Intergenic
1161824102 19:6551064-6551086 GCTGAGAGCTGAGCACTCAATGG - Intergenic
1162536605 19:11266125-11266147 GCTCTGAGCAGATGGCTCACTGG + Intergenic
1164575111 19:29401377-29401399 GCTGGGAGCTCACCTCTCACGGG + Intergenic
1166357184 19:42234058-42234080 GCTGAGAACAGAGGGCTGACAGG + Intronic
1167645263 19:50702379-50702401 GCAGAGAGCAGACCATTCTCGGG - Intronic
925628845 2:5868559-5868581 GCTCAGAGCAGCCCACACACAGG - Intergenic
930729049 2:54709871-54709893 GCTGAGAGCTGAACACTCATTGG + Intergenic
933624652 2:84585504-84585526 GCTGAGAGCTGAACACTCAATGG - Intronic
934789810 2:97049657-97049679 CCTGTGAGCAGAACACTCACTGG + Intergenic
934816659 2:97332882-97332904 CCTGTGAGCAGAACACTCACTGG - Intergenic
934821037 2:97375602-97375624 CCTGTGAGCAGAACACTCACTGG + Intergenic
934883676 2:98006023-98006045 GCTGAGAGCAGGCTGCTCAAGGG - Intergenic
939877959 2:147599127-147599149 GCTGAGTGCAGACACCCCACAGG + Intergenic
940897845 2:159097696-159097718 GCTGTGGGAAGACTGCTCACAGG - Exonic
946197390 2:218043219-218043241 CCTGAGAGCTGAACACTCACTGG - Intronic
948157688 2:235797496-235797518 GATGAGAGCAGAAGGATCACAGG - Intronic
948185236 2:236016010-236016032 GCTGAGAGCAGGGCGTTCAGCGG - Intronic
948395984 2:237645406-237645428 GCAGTGAGCAGACCACTCAAAGG - Intronic
1170004214 20:11647373-11647395 GCTGAGAGCTGAACACTCATTGG + Intergenic
1170458408 20:16554430-16554452 GCTGAGCGCTGAACGCTCATCGG + Intronic
1176096605 20:63347230-63347252 GCTGAGAGCAGACCGCTCACGGG - Intronic
1178244441 21:30937016-30937038 GCTGAGAGCTGAACTCTCAATGG + Intergenic
1179164235 21:38923639-38923661 GCTGAGAGGACAAAGCTCACTGG - Intergenic
1179472314 21:41619928-41619950 GCTGTGAGCAGATCTTTCACTGG + Intergenic
1179825692 21:43964900-43964922 GGTGAGAGCAGACCTCACAGTGG + Intronic
1181962608 22:26633675-26633697 GCAGAGAGCAGATCACTCATGGG - Intergenic
1182671144 22:31996986-31997008 GCTGAGAGAAGACACCTCCCTGG - Intergenic
1183417619 22:37691541-37691563 GCTGAGAGCAGGCCTCCCCCAGG + Exonic
1184045708 22:41971197-41971219 GCTGGAGGCAGACTGCTCACTGG + Intergenic
950336103 3:12194735-12194757 GCTCAGAGAAGACCGCACCCTGG + Intergenic
951182245 3:19672106-19672128 GCTGAGAGCTGAACACTCATTGG - Intergenic
952321554 3:32282616-32282638 GCTGAGAGCAGACCGGTGTAGGG - Intronic
952408587 3:33026806-33026828 GCTGAGAGCTGAACACTCGCTGG + Intronic
955111854 3:55958170-55958192 GCTGAGAGCTGAACACTCATTGG - Intronic
955238369 3:57159726-57159748 CCTTAGAGCAGACCTCTCTCTGG - Intronic
957427069 3:80052013-80052035 GCTGAGAGCTGAACACTCATGGG + Intergenic
958678094 3:97292811-97292833 GCTGAGAGCAGGACGCTCACCGG - Intronic
958678171 3:97293295-97293317 GCTGAGAGCTGGACACTCACTGG - Intronic
961006861 3:123411361-123411383 GCAGGGAGCAGACCCCTGACAGG + Intronic
961342827 3:126240246-126240268 GCTGAGAAGTGACTGCTCACAGG + Intergenic
966256180 3:177918375-177918397 GCTGAGAGCTGAACACTGACAGG + Intergenic
966351591 3:179037457-179037479 GCTGAGTGCAGATCCCTCAGCGG + Intronic
966764646 3:183449540-183449562 GCTTAGAGCAGCTTGCTCACTGG - Intergenic
968540756 4:1167229-1167251 GCTGAGAGCAGACGGGACACGGG + Exonic
974585984 4:63878004-63878026 GCTGAGAAGAGAACCCTCACTGG - Intergenic
978663384 4:111154345-111154367 ACTGAGAGCTGAACACTCACGGG - Intergenic
980574337 4:134666085-134666107 GCTGAGAGCTGAACACTCATGGG - Intergenic
985634989 5:1031467-1031489 CCTGAGAGCAGGCAGCTCTCGGG - Intronic
985813721 5:2111069-2111091 GCTGGAGGCAGACAGCTCACTGG + Intergenic
988986284 5:36622033-36622055 GTTGATAGCACACCACTCACTGG - Intronic
994593927 5:101807138-101807160 GCTAAGAGCTGAACACTCACTGG + Intergenic
999887127 5:155936393-155936415 GCTGCGAGCTGAACACTCACTGG - Intronic
1002523602 5:179804263-179804285 GGTGACAGCAGACCGTTAACGGG - Intronic
1002689100 5:181037894-181037916 GCTGAGAGCTGAACACTCAGTGG + Intergenic
1004520900 6:16359615-16359637 GCTGAGAGCTGAACACTCAATGG + Intronic
1013087909 6:106872190-106872212 CCTGAGAGCAGGCAGCTCTCCGG - Intergenic
1014116389 6:117672962-117672984 ACTGAGAGCAGACTGCTTTCTGG - Intergenic
1015143351 6:129959171-129959193 GCTGAGAGCTGAACACTCATGGG + Intergenic
1018191529 6:161313585-161313607 GCTGAGTGCAAACAGCTCGCAGG + Intergenic
1019385128 7:750804-750826 GCTGTCAGCAGACCCCTCCCCGG + Intronic
1019541806 7:1555045-1555067 GCTGAGGGCAGAGCGCCCACCGG - Intronic
1019993314 7:4707405-4707427 GCTGAAAGCAGGCCTCTCCCTGG + Intronic
1020010674 7:4804178-4804200 GCAGAGAGCAGCCCGCACACAGG - Intronic
1021373174 7:19875895-19875917 GCTGAGAGCAAACCCCTCAGTGG + Intergenic
1022423399 7:30245724-30245746 GCTGAGAGCTGAACACTCATTGG - Intergenic
1022795535 7:33728595-33728617 GCTGAAACCAGACCGCTTTCTGG + Intergenic
1023699989 7:42883272-42883294 GCTGAGAGCTGAACACTCACTGG - Intergenic
1027246833 7:76373360-76373382 GCAGAGAGCAGACAGGTCCCTGG + Intergenic
1028527367 7:91801086-91801108 GCTCAGAGCTGAACACTCACTGG - Intronic
1030337092 7:108339341-108339363 GCTGAGTGCAAACAGCTCGCAGG - Intronic
1031836502 7:126686149-126686171 GCTGAGAGATGAACACTCACTGG + Intronic
1032858574 7:135857784-135857806 ACTGAGAGCTGAACACTCACTGG - Intergenic
1033540924 7:142355315-142355337 GCTGAGAGCACAGAGCTCTCAGG - Intergenic
1040759400 8:50820772-50820794 GCTGGGAGCATACCTCTGACAGG + Intergenic
1043734185 8:83723853-83723875 GCTGAGAGCTGAACACTCATTGG - Intergenic
1044774910 8:95677958-95677980 GCTGAGAGCTGAACACTCACTGG - Intergenic
1061304728 9:129725669-129725691 GCCCAGAGCAGAGCACTCACGGG + Intergenic
1061864359 9:133484897-133484919 GCTGAGGGCAGGCCCCTCCCAGG + Intergenic
1062429628 9:136521246-136521268 GCAGTGAGCACACCCCTCACCGG + Intronic
1062446309 9:136596853-136596875 GCTGAGGGGAGACCCCTCTCTGG + Intergenic
1189969414 X:46402791-46402813 GCTGAGAATAGACCGTTGACTGG - Intergenic
1192585068 X:72312947-72312969 GAAGAGAGCAGAGCGATCACAGG + Intergenic
1195454224 X:105050789-105050811 GCTGAGAGCTGAACACTCAGGGG - Intronic
1196751468 X:119121412-119121434 GCTGAGAGCTGACAGCTGTCTGG + Intronic
1199637629 X:149828349-149828371 GCTGAGAGGAAACAGCTCTCAGG - Intergenic