ID: 1176097537

View in Genome Browser
Species Human (GRCh38)
Location 20:63351194-63351216
Sequence CGTGGACGTGGGTGTGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 686
Summary {0: 2, 1: 0, 2: 11, 3: 108, 4: 565}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176097537 Original CRISPR CGTGGACGTGGGTGTGGATG TGG (reversed) Intronic