ID: 1176097544 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:63351224-63351246 |
| Sequence | CGTGGACGTGGGTGTGGATG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 686 | |||
| Summary | {0: 2, 1: 0, 2: 11, 3: 108, 4: 565} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1176097544_1176097550 | 3 | Left | 1176097544 | 20:63351224-63351246 | CCACATCCACACCCACGTCCACG | 0: 2 1: 0 2: 11 3: 108 4: 565 |
||
| Right | 1176097550 | 20:63351250-63351272 | ACGTCCACGTCCACACACAGAGG | No data | ||||
| 1176097544_1176097553 | 20 | Left | 1176097544 | 20:63351224-63351246 | CCACATCCACACCCACGTCCACG | 0: 2 1: 0 2: 11 3: 108 4: 565 |
||
| Right | 1176097553 | 20:63351267-63351289 | CAGAGGCATTCTCACGTCACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1176097544 | Original CRISPR | CGTGGACGTGGGTGTGGATG TGG (reversed) | Intronic | ||