ID: 1176097544

View in Genome Browser
Species Human (GRCh38)
Location 20:63351224-63351246
Sequence CGTGGACGTGGGTGTGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 686
Summary {0: 2, 1: 0, 2: 11, 3: 108, 4: 565}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176097544_1176097550 3 Left 1176097544 20:63351224-63351246 CCACATCCACACCCACGTCCACG 0: 2
1: 0
2: 11
3: 108
4: 565
Right 1176097550 20:63351250-63351272 ACGTCCACGTCCACACACAGAGG No data
1176097544_1176097553 20 Left 1176097544 20:63351224-63351246 CCACATCCACACCCACGTCCACG 0: 2
1: 0
2: 11
3: 108
4: 565
Right 1176097553 20:63351267-63351289 CAGAGGCATTCTCACGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176097544 Original CRISPR CGTGGACGTGGGTGTGGATG TGG (reversed) Intronic