ID: 1176097713

View in Genome Browser
Species Human (GRCh38)
Location 20:63351975-63351997
Sequence CCCATTGGTGGGGACTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 140}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176097713_1176097725 14 Left 1176097713 20:63351975-63351997 CCACAGAAGTCCCCACCAATGGG 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1176097725 20:63352012-63352034 ATTAAATCCCCAGCGTTGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 109
1176097713_1176097732 26 Left 1176097713 20:63351975-63351997 CCACAGAAGTCCCCACCAATGGG 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1176097732 20:63352024-63352046 GCGTTGGCAGGCATGGGGCCAGG 0: 1
1: 0
2: 2
3: 33
4: 288
1176097713_1176097722 10 Left 1176097713 20:63351975-63351997 CCACAGAAGTCCCCACCAATGGG 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1176097722 20:63352008-63352030 CCCCATTAAATCCCCAGCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 57
1176097713_1176097729 21 Left 1176097713 20:63351975-63351997 CCACAGAAGTCCCCACCAATGGG 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1176097729 20:63352019-63352041 CCCCAGCGTTGGCAGGCATGGGG 0: 1
1: 0
2: 0
3: 17
4: 179
1176097713_1176097726 19 Left 1176097713 20:63351975-63351997 CCACAGAAGTCCCCACCAATGGG 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1176097726 20:63352017-63352039 ATCCCCAGCGTTGGCAGGCATGG 0: 1
1: 0
2: 2
3: 13
4: 147
1176097713_1176097727 20 Left 1176097713 20:63351975-63351997 CCACAGAAGTCCCCACCAATGGG 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1176097727 20:63352018-63352040 TCCCCAGCGTTGGCAGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176097713 Original CRISPR CCCATTGGTGGGGACTTCTG TGG (reversed) Intronic
901657161 1:10775999-10776021 CCCACTGATGGGGACTTGGGAGG - Intronic
902404938 1:16177444-16177466 CCCCTTGGTGGTGGCATCTGGGG - Intergenic
903657743 1:24959404-24959426 CCCTTTGATGGCGGCTTCTGAGG - Intronic
903773218 1:25777246-25777268 CCCATGGCTGGGGTCCTCTGGGG - Intronic
904578535 1:31522577-31522599 CCCAGCTGTGGGGACTGCTGTGG + Intergenic
905172674 1:36118433-36118455 CCCACTGGAGTGGACTCCTGAGG - Intronic
905796299 1:40818432-40818454 CCCGGAGGCGGGGACTTCTGGGG - Intronic
907978815 1:59460446-59460468 CCCAGTGGTGGGGTCTACAGAGG - Intronic
909555575 1:76949928-76949950 CCCATTGCTGAGGAAGTCTGTGG + Intronic
912554156 1:110504161-110504183 CCCAGTGCTGGAGACTTGTGAGG + Intergenic
916633081 1:166638027-166638049 CCCAGTGGAGTGGACTTATGGGG - Intergenic
919652734 1:200166313-200166335 CACCTTTGTGGGGACTTCTCTGG - Intronic
920437834 1:205959632-205959654 CCCCATGGTGGGGACACCTGTGG - Intergenic
1069634314 10:69916236-69916258 CCCATTGGGTGTGACTGCTGTGG - Intronic
1070678269 10:78430452-78430474 TCTATAGGTGGGCACTTCTGTGG - Intergenic
1071300712 10:84254024-84254046 CCCAATGGTGGGGATGTCAGTGG - Intronic
1075835314 10:125448011-125448033 CGCATTAGTGTGGTCTTCTGGGG - Intergenic
1076129345 10:128002101-128002123 CCCAGTTGTGGGGACCTCCGGGG + Intronic
1076144447 10:128106064-128106086 CACATTTGTGGGGACTCCAGTGG - Exonic
1076615622 10:131752287-131752309 CCCACTGAAGGGGGCTTCTGGGG - Intergenic
1076978880 11:194921-194943 CCCATTTGTGTGTACCTCTGTGG - Intronic
1079686971 11:23371053-23371075 CCCAGTGGTGGTGACCACTGGGG + Intergenic
1080259331 11:30329092-30329114 CACATTTGTGGATACTTCTGAGG - Intronic
1084083934 11:66846133-66846155 CCCCTTGGTGGGGAGGGCTGGGG - Exonic
1084308875 11:68304454-68304476 CCCATTGGAGGGGAAATGTGGGG + Intergenic
1085397430 11:76213727-76213749 GGCATTGGGGGGGACATCTGGGG - Intergenic
1085443100 11:76580589-76580611 CCCAGAGGAGGGGCCTTCTGAGG + Intergenic
1085617285 11:78010550-78010572 GTCATTGGTTGGGACTTCTGGGG + Intergenic
1088025163 11:105170916-105170938 ACCATTGGTGGGAACTTTGGAGG + Intergenic
1089615037 11:119690536-119690558 CCCTTTGGTGGGGGCTCCTGAGG - Intronic
1090166751 11:124557235-124557257 CCCATTTGTGGGCATTTTTGAGG - Intergenic
1090487588 11:127127797-127127819 GCAAATGGTGCGGACTTCTGTGG + Intergenic
1093660668 12:21753035-21753057 CAGATTGGTGGGAAGTTCTGTGG + Intronic
1094849039 12:34374110-34374132 CCCGTGGGTGGGGACCTCTGCGG + Intergenic
1098340724 12:69448190-69448212 CCCATTGGTGGGGATTGGTATGG + Intergenic
1108730225 13:53227737-53227759 CCAAGTGGTGGGGACTACAGGGG - Intergenic
1110916699 13:81030289-81030311 CCCAGTGGTGGTGACCACTGGGG - Intergenic
1113558760 13:111259320-111259342 CCCAATGGTGGTGACTACAGGGG + Intronic
1113735061 13:112672579-112672601 CCTCTTGGTGGGGCCTGCTGGGG - Intronic
1114651122 14:24285085-24285107 CACATTAGTGGGGACACCTGGGG + Intergenic
1118715522 14:68556945-68556967 CCCAATGCCGGGGACTCCTGAGG - Intronic
1122942372 14:104987145-104987167 CCCATTGGTGGGGGCTGCACTGG + Intronic
1124373742 15:29117536-29117558 CCCCTTGGCTGGGACGTCTGGGG + Exonic
1128744620 15:70104648-70104670 GCCAGTGGAGGGGAGTTCTGGGG + Intergenic
1128746794 15:70120367-70120389 CCCATTGCTGGGTGCTACTGGGG - Intergenic
1129152954 15:73700535-73700557 CCCCTTGGAGGGGACATTTGGGG - Intronic
1129561871 15:76578440-76578462 CCCAGTGGTGGGGGCTACAGGGG + Intronic
1131951813 15:97689582-97689604 CCCAATGGTGGTGAGTACTGGGG - Intergenic
1133026693 16:2991716-2991738 CCTGTGGGTGGGGACTCCTGTGG + Intergenic
1133582344 16:7157891-7157913 CCCATTGGTAGAGACTTCCGAGG + Intronic
1140268801 16:73444266-73444288 TCCCTTGGGTGGGACTTCTGAGG + Intergenic
1141551918 16:84812004-84812026 GCCACTGCTGGGGACTTTTGTGG + Intergenic
1144961951 17:19049412-19049434 CCCATTTGTGGGGTCCTCTCTGG - Intergenic
1144973210 17:19125110-19125132 CCCATTTGTGGGGTCCTCTCTGG + Intergenic
1146766111 17:35523355-35523377 CCCATTAGTGGGGACTGTTCAGG - Intronic
1146914896 17:36672161-36672183 CCCACTGGTGGGGTCTGGTGGGG + Intergenic
1148463857 17:47852826-47852848 CACATTGGTAGGGTCTCCTGGGG + Intronic
1149547912 17:57518136-57518158 CCCAGTGCAGGGAACTTCTGAGG - Intronic
1151128203 17:71867696-71867718 GCCATTTGTGGGTACTGCTGGGG + Intergenic
1151321453 17:73354978-73355000 CCCAGTGGTGGGAACTGCTGAGG + Intronic
1152595523 17:81236005-81236027 CCCCTGAGTGGGGAATTCTGGGG - Intronic
1152688892 17:81708509-81708531 CCCACTGGCTGGGACTCCTGGGG + Intergenic
1152852243 17:82644261-82644283 CCCACTGCAGGGGCCTTCTGTGG + Intronic
1153285700 18:3452299-3452321 CGCATCGGTGGGAACTTCCGCGG + Exonic
1155591078 18:27428371-27428393 AGCAGTGGTGGGGGCTTCTGGGG - Intergenic
1155776259 18:29765721-29765743 CCCAGTTTTGGGGATTTCTGTGG - Intergenic
1156879875 18:42064014-42064036 TCCAGAGGTGGGGCCTTCTGGGG - Intronic
1157448245 18:47764550-47764572 ACCATTGATGGGCACTTATGTGG - Intergenic
1157658898 18:49421047-49421069 CCCATTGGTGGAGTCTACAGAGG - Intronic
1158147907 18:54336451-54336473 CGCATTGGTGGGGAGGTCTCAGG - Intronic
1161038155 19:2096702-2096724 CCCAGTGGCGGAGTCTTCTGAGG + Intronic
1161511568 19:4675114-4675136 GCCATCTGTGGGGACTCCTGGGG - Intergenic
1162566057 19:11446365-11446387 CCCTTGGTTGGGGACTTCTAGGG + Intronic
1166840084 19:45692033-45692055 ACCGTTGGTGGGGAATGCTGTGG - Exonic
1167037231 19:47001627-47001649 GCCCTTGGTGGGGACAGCTGGGG + Exonic
1167125227 19:47544715-47544737 GCCAGTGGTGGGGGCTGCTGCGG + Exonic
1167331414 19:48858880-48858902 TCCAGTGCTGGGGACTCCTGGGG + Exonic
926117662 2:10223609-10223631 CTCTGTGGTGGGGGCTTCTGGGG + Intergenic
936875443 2:117183975-117183997 ATCATTGCTGAGGACTTCTGAGG + Intergenic
937040963 2:118820325-118820347 CCCTTTGCTGGTGACTCCTGGGG + Intergenic
937057263 2:118949560-118949582 CCCACTGTAGGGCACTTCTGTGG - Intronic
937739582 2:125334035-125334057 CCCATTGGTGGTGGCTACAGTGG + Intergenic
947497633 2:230649785-230649807 CCCATTGGAGAGGCCTTCTTTGG - Intergenic
948300378 2:236901998-236902020 CCCATTTGTGTAGACGTCTGTGG - Intergenic
948861340 2:240754157-240754179 CCCAAAGGTGGGGACTGCTGGGG + Intronic
1169087686 20:2837643-2837665 GCCTTTGGTGGAGGCTTCTGAGG - Intronic
1172363517 20:34331651-34331673 CCCAGTAGTGGGGACTACTACGG - Intergenic
1174067749 20:47878032-47878054 TCTATTGGTGGGGGCTTCTGGGG + Intergenic
1175955344 20:62606121-62606143 GCCACTGGTGGGGACCACTGAGG + Intergenic
1176097713 20:63351975-63351997 CCCATTGGTGGGGACTTCTGTGG - Intronic
1176107467 20:63396173-63396195 CTCAGTGGTGTGGACATCTGAGG + Intergenic
1178022039 21:28419535-28419557 CACCTTGGTGGGCAGTTCTGGGG - Intergenic
1178412044 21:32372443-32372465 CACATATGTGGTGACTTCTGAGG + Intronic
1180154511 21:45971512-45971534 CCCAAGGGTGGGGACTCCAGAGG + Intergenic
1180869494 22:19138253-19138275 CCCACTCGAGGGGACTCCTGGGG + Exonic
1181726814 22:24817112-24817134 CCCTTTGATGTGGACATCTGTGG - Intronic
1182318312 22:29462567-29462589 CCCAGTGTTGGGGACCACTGTGG + Intergenic
1182452683 22:30430514-30430536 CCCGTTGGTGGTAACTTGTGAGG + Intergenic
949515099 3:4800437-4800459 CCCACTGGTCGGGACTCCTGTGG + Exonic
950519089 3:13485532-13485554 CCCATTTGAGGGGCCTTCAGGGG + Intronic
952492876 3:33888556-33888578 CCCTATGGTGGGGGCCTCTGGGG + Intergenic
962015264 3:131432330-131432352 CCCATTGGTGGGGGCCACAGGGG + Intergenic
967810946 3:193760606-193760628 CCCACTGGAGGGGTCTTCTGGGG - Intergenic
967817861 3:193814511-193814533 TCATTTGGTGAGGACTTCTGTGG - Intergenic
969429571 4:7146277-7146299 CCCATTGCTGTGGGCTCCTGAGG + Intergenic
969589931 4:8115980-8116002 GCCATCCGTGGGGACTTCTGTGG - Intronic
970546403 4:17134505-17134527 CCCATTGATGGGGATATCGGTGG - Intergenic
971170544 4:24228700-24228722 CTCATTGTTGGGAGCTTCTGAGG - Intergenic
972209931 4:36824278-36824300 CCCACAGGTGGAGAGTTCTGGGG - Intergenic
974956333 4:68645829-68645851 CCCAGAGGTGGGGCCTTCAGAGG + Intronic
976975853 4:91165529-91165551 CCCAGTGGTGGGGTCTACAGAGG + Intronic
978494044 4:109340121-109340143 CCCAGAGGTGGGGACTACAGAGG - Intergenic
981114014 4:140968772-140968794 CCTCTTGGTGAGGAGTTCTGGGG + Intronic
982311327 4:153988372-153988394 CCCCTGGGTGGCCACTTCTGGGG + Intergenic
985516254 5:346452-346474 CCCTGTGGTGGGGCCGTCTGGGG - Intronic
987015528 5:13814845-13814867 CCCTTTGGTGGGGTATTCTAGGG - Exonic
988948269 5:36229870-36229892 GCCATAGGTGGGGAATTCTTGGG - Intronic
990678655 5:58216444-58216466 CCCATTGGTGGAGCCTACAGAGG - Intergenic
993169281 5:84396499-84396521 CTCAGTGGTGTGGACTTCTGTGG + Intergenic
993874786 5:93293547-93293569 CACATTGGTGGGGACGCCTTAGG + Intergenic
1002181400 5:177432842-177432864 CCCAGCGGAGGGGGCTTCTGGGG + Intronic
1006168713 6:32081055-32081077 CCGAATGGTGAGGACATCTGTGG + Intronic
1006202990 6:32313551-32313573 CCAATTTGTTGGGACTTGTGAGG + Intronic
1007606616 6:43122329-43122351 CCAAGTGGTGGGGACTTGAGAGG + Intronic
1009597711 6:65756967-65756989 CCCAGTAGTGGGGATTGCTGGGG - Intergenic
1019309433 7:353057-353079 CCCATTTATGGGGTCTTCAGGGG + Intergenic
1019496077 7:1341257-1341279 CCCATGGCTGGGGACTTCTTTGG + Intergenic
1021772841 7:24022316-24022338 GGCATTGGTTGGAACTTCTGAGG + Intergenic
1025832425 7:65064200-65064222 CCAGTGGGAGGGGACTTCTGAGG - Intergenic
1025902193 7:65753737-65753759 CCAGTGGGAGGGGACTTCTGAGG - Intergenic
1026131078 7:67621453-67621475 CCCTTTTGGGGGCACTTCTGTGG + Intergenic
1026607336 7:71827211-71827233 CCCATTGGTGGGTCCTCCGGCGG + Intronic
1027241933 7:76336339-76336361 CCCTCTGGTGGGGGCTGCTGAGG + Intronic
1028537790 7:91909154-91909176 CCCATTGGTGGAGCCTACAGAGG + Intergenic
1032469950 7:132170999-132171021 CCCAGTGGTGGGGAGAACTGGGG - Intronic
1032597106 7:133253014-133253036 CCCATTGGTGGAGACTCCTGCGG + Intergenic
1037560110 8:20065904-20065926 CCAATTGGTGTTGGCTTCTGGGG + Intergenic
1043473293 8:80582090-80582112 CCTATTGGTATGGACTTTTGAGG + Intergenic
1044756686 8:95470043-95470065 TCCACTGGTGAGGACTTCTCTGG - Intergenic
1045411572 8:101925949-101925971 CCCATTGCAGGGGACTCCTGAGG - Intronic
1046111974 8:109736346-109736368 GCCATTTGGGGGGACTTCTTGGG + Intergenic
1050174235 9:2853190-2853212 CCCATTGGTCTGGTCTGCTGAGG - Intergenic
1050442855 9:5683737-5683759 CCCAGAGGTGGAGACTGCTGAGG + Intronic
1051923892 9:22299648-22299670 CCCCTTGGTGGGGAGGTTTGTGG + Intergenic
1053014789 9:34655584-34655606 CCCTGTGGAGGGCACTTCTGAGG - Exonic
1055807636 9:80114617-80114639 TCAAATGGTGGGAACTTCTGTGG - Intergenic
1058683647 9:107462170-107462192 CCCTTTGTGGGGAACTTCTGAGG - Intergenic
1186418554 X:9404996-9405018 GCCATTGGTAGGGTCTTCCGTGG + Intergenic
1186418896 X:9407903-9407925 GCCATTGGTAGGGTCTTCCGTGG + Intergenic
1186419007 X:9408834-9408856 GCCATTGGTAGGGTCTTCCGTGG + Intergenic
1186419115 X:9409765-9409787 GCCATTGGTAGGGTCTTCCGTGG + Intergenic
1191027850 X:55934819-55934841 CCCCTTGGTGGGGAATGGTGAGG + Intergenic
1191111061 X:56803386-56803408 CTCTTTTGTGGGGAGTTCTGGGG - Intergenic
1194065376 X:89253996-89254018 CTCACTGGTGGTGACTACTGAGG + Intergenic
1200719545 Y:6588080-6588102 CTCACTGGTGGTGACTACTGAGG + Intergenic