ID: 1176100026

View in Genome Browser
Species Human (GRCh38)
Location 20:63360647-63360669
Sequence CCTTTTCTGCAGGAAGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 285}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176100026_1176100034 -4 Left 1176100026 20:63360647-63360669 CCTTGTCCTTCCTGCAGAAAAGG 0: 1
1: 0
2: 0
3: 28
4: 285
Right 1176100034 20:63360666-63360688 AAGGTGGGTGGCGGCCGCCAAGG 0: 1
1: 0
2: 0
3: 13
4: 146
1176100026_1176100040 28 Left 1176100026 20:63360647-63360669 CCTTGTCCTTCCTGCAGAAAAGG 0: 1
1: 0
2: 0
3: 28
4: 285
Right 1176100040 20:63360698-63360720 ACCCCTCTGATCCCCTAAACCGG 0: 1
1: 0
2: 0
3: 4
4: 85
1176100026_1176100036 3 Left 1176100026 20:63360647-63360669 CCTTGTCCTTCCTGCAGAAAAGG 0: 1
1: 0
2: 0
3: 28
4: 285
Right 1176100036 20:63360673-63360695 GTGGCGGCCGCCAAGGGCAGAGG 0: 1
1: 0
2: 0
3: 22
4: 259
1176100026_1176100035 -3 Left 1176100026 20:63360647-63360669 CCTTGTCCTTCCTGCAGAAAAGG 0: 1
1: 0
2: 0
3: 28
4: 285
Right 1176100035 20:63360667-63360689 AGGTGGGTGGCGGCCGCCAAGGG 0: 1
1: 0
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176100026 Original CRISPR CCTTTTCTGCAGGAAGGACA AGG (reversed) Intronic
900830058 1:4959496-4959518 CCTGTGATGCAGGAAGGAAAAGG - Intergenic
901118803 1:6873359-6873381 CCTTTAGTGCTAGAAGGACATGG - Intronic
902129557 1:14247573-14247595 CCTTTGGTGCAGAAAGGAAATGG + Intergenic
902719441 1:18294473-18294495 CCTCTTCTGTAGTAAGAACAGGG - Intronic
902725597 1:18334020-18334042 GCTTTTGTGCTGCAAGGACAGGG + Intronic
902768565 1:18632466-18632488 CCTTTTCTCCAGCCAGGACCCGG - Intronic
903732027 1:25503675-25503697 CCTCCTCTGCACGGAGGACAGGG + Intergenic
904599221 1:31664657-31664679 CCTTGTCACCAGGCAGGACACGG + Intronic
905999811 1:42414694-42414716 CCTATTTGGCAGCAAGGACATGG - Exonic
907047909 1:51311248-51311270 CCCTACCTGCAGGAAGGTCAGGG + Exonic
907278337 1:53328900-53328922 TGTCTTCTGCAGGAAGGAGAAGG + Intergenic
908236526 1:62152343-62152365 CCTTTTCTGCCGGAACGCCCTGG - Intronic
908979145 1:69933036-69933058 CCTGTGCTGGAGGGAGGACAGGG - Intronic
909924536 1:81423814-81423836 CCTTTGCTTCAGTAATGACATGG - Intronic
909980036 1:82088271-82088293 CCATTTCTGCAGGAAGCATTAGG - Intergenic
910849227 1:91634974-91634996 CCTTCTCAGCAGGAAGAACTTGG + Intergenic
912246992 1:107969843-107969865 CCTGAACTGCAGGAAAGACAAGG + Intergenic
912932844 1:113980191-113980213 CCTTTTCTGCAGGAGTGGAAGGG + Intronic
915117654 1:153610711-153610733 CTTTTTCTGAAGGAAGGATAGGG + Intronic
915442120 1:155951766-155951788 CCATTTCTGCAGGATCGAAATGG - Exonic
916443916 1:164854546-164854568 GCTTTTATGCAGGAATGAGAGGG - Intronic
917790309 1:178495098-178495120 CCTTTTCTGTAGAAAGGATGGGG - Intergenic
919745461 1:201005827-201005849 CCTGTCCTGCAGAAAGGTCATGG - Intronic
919860293 1:201735424-201735446 CATTTCCTGCAGGAAGGGCCTGG + Intronic
921244796 1:213226329-213226351 CCTTTGCAGAAGGAAGGCCATGG + Intronic
921264089 1:213408051-213408073 CTTTTACTGCTGGAAGCACAGGG + Intergenic
922795450 1:228337424-228337446 CCTTCTCTTCAGGAAGGTCAGGG - Intronic
923047654 1:230367333-230367355 CCTTTCATGGAGGAAGGACTAGG - Intronic
1063353402 10:5376328-5376350 CCCTTTGTGGAGGAAGGAGAGGG - Intergenic
1063648330 10:7908268-7908290 CTTTTTCTGCCTGAAGGCCATGG + Intronic
1063946397 10:11180399-11180421 CCTCATCTGCAGGATGAACAGGG + Intronic
1064508565 10:16063770-16063792 CTTCTCCTGCAGGAAGCACAAGG + Intergenic
1068606118 10:59006883-59006905 CCTTTTCTGTAACAAGGTCAAGG - Intergenic
1069323577 10:67203906-67203928 CCTTTTCTGTAGTAATGAAATGG - Intronic
1069759064 10:70795408-70795430 TCTTGTCTGCAATAAGGACAGGG + Intergenic
1070594702 10:77824378-77824400 CCTTACCTTCAGGAGGGACAGGG + Exonic
1070680244 10:78443960-78443982 GCGTTTTTGCAGGAAGGACTGGG + Intergenic
1070833374 10:79433585-79433607 CCTTTCCTGGAGCAAGGCCAAGG + Intronic
1071083105 10:81836519-81836541 CCATTCTTGCAGGAAGGACAAGG + Intergenic
1071479844 10:86056928-86056950 CCAGCTCTGCAGGAAGCACAAGG - Intronic
1071695499 10:87864384-87864406 CTTCTTCTGCAGGATGGAAATGG - Exonic
1073293719 10:102425741-102425763 CCTAAGCTGCAGGAAGGGCAGGG - Intronic
1074187999 10:111113639-111113661 CCTCTTCTTCAGAAAGTACAAGG + Intergenic
1075727353 10:124617378-124617400 CCTTGTCGGCAGTGAGGACATGG - Exonic
1076135752 10:128045005-128045027 CCATCCCTGCAGGCAGGACATGG + Intronic
1076474769 10:130744247-130744269 CCTTGTCTGCAGGGACGGCAGGG - Intergenic
1077158527 11:1102217-1102239 CCCATTCTGCAGGACGGACCAGG - Intergenic
1077187195 11:1240677-1240699 CCGTTTCTGCATGAGGGACTGGG - Intronic
1077485819 11:2837965-2837987 CTCTGTCTGCAGGAAGGAGAGGG + Intronic
1081431642 11:42982964-42982986 CCATTTCAGCAGGAAGGATGAGG - Intergenic
1081699158 11:45141861-45141883 CCTTACCTGCAGGGAGGCCAGGG + Intronic
1084008214 11:66334219-66334241 CATGTTCTGCCGGAGGGACAGGG + Exonic
1084184948 11:67466607-67466629 CCGCTTCTCCAGGAAGGCCAAGG - Intronic
1084638620 11:70410642-70410664 TCTTCTCTCCAGGAAGGAAAAGG - Intronic
1085061590 11:73452390-73452412 GCTTTTTGGCAGGAAGGACAGGG - Intronic
1085520750 11:77137746-77137768 CCTCTTCTGCAGGATGGACGTGG + Intronic
1086796840 11:91115581-91115603 CCTTTCATGCAAGAAGGAAAGGG - Intergenic
1087890124 11:103528431-103528453 CAATTTCTGTAGGAAAGACATGG - Intergenic
1088091558 11:106046173-106046195 CCTAGTCTGTAGGAAGGACTTGG + Intergenic
1088168918 11:106972577-106972599 TCTTTTTTGCTGGAAGAACATGG - Intronic
1089291895 11:117442746-117442768 CCTCTTCTTCAGGAAGGGAAGGG - Intronic
1089743127 11:120598802-120598824 CCTCTTCTGCAAGATAGACAGGG - Intronic
1090626546 11:128613691-128613713 TCTTTTCTACAGGAAGGGAAGGG - Intergenic
1090828958 11:130407687-130407709 CTTACTCTGCAGGAAGTACATGG + Intronic
1091823484 12:3492725-3492747 CCGTTTCTCCAGGAAGGTAAGGG - Intronic
1093117156 12:15225283-15225305 CCTTTTCTGATGGGAGGAGAGGG - Intronic
1096874122 12:54614035-54614057 CCTTTTCCTCAGCAAGGAGAGGG + Intergenic
1097637845 12:62144114-62144136 CCTTCTCTGCAGGAAACAAATGG + Intronic
1102485356 12:113251776-113251798 CTTTTTCTGCAGGCAAGCCATGG + Intronic
1103913722 12:124365421-124365443 GCTCATCTGCAGGAAGGAGATGG - Intronic
1105815500 13:24032586-24032608 CCATTACTGCAGAAACGACAGGG - Intronic
1106788366 13:33129712-33129734 CCTTTTCTGCAGGCAGGTGGCGG + Exonic
1107265366 13:38546823-38546845 CCTTCTCAGCAGGAAGAACTAGG - Intergenic
1108485266 13:50917215-50917237 GCTTTTCTGGAAGAAGGAAAGGG + Intronic
1108572749 13:51767268-51767290 CCTTTTCTGCAGGAGGATGATGG - Exonic
1112541102 13:100313823-100313845 GCTTTTTTGCAGGAATGAAATGG - Intronic
1112872676 13:103994048-103994070 CTTTATCAGCAGCAAGGACACGG + Intergenic
1113344635 13:109465285-109465307 GCTTTTCTGCAGCATGCACATGG - Intergenic
1113506231 13:110818394-110818416 CTTGTTCTTCAGGAAGGACATGG - Intergenic
1114043550 14:18702167-18702189 CCCCCTCAGCAGGAAGGACAGGG + Intergenic
1114047834 14:18892609-18892631 CCCCCTCAGCAGGAAGGACAGGG + Intergenic
1114114687 14:19509034-19509056 CCCCCTCAGCAGGAAGGACAGGG - Intergenic
1114116382 14:19626797-19626819 CCCCCTCAGCAGGAAGGACAGGG - Intergenic
1115742046 14:36398825-36398847 GCTGTTCTGAAGGAAAGACATGG - Intergenic
1116056820 14:39874211-39874233 CCTGATCAGCAGGAAGCACAGGG - Intergenic
1117052824 14:51879013-51879035 CCTTTTGTGAACCAAGGACAGGG - Intronic
1117770094 14:59125433-59125455 CCTTTACTTCAGGGAGGGCAAGG + Intergenic
1118745553 14:68770529-68770551 CCTTTTCAGGAGAGAGGACAGGG - Intergenic
1119405270 14:74394935-74394957 CTGTTTCTGGAGGAAGGACCAGG + Intergenic
1120405447 14:84089327-84089349 CCTTCTCTTCACGGAGGACATGG + Intergenic
1121132183 14:91458501-91458523 CCTTTTCTCAGGGAAGGAAATGG - Exonic
1121266127 14:92603777-92603799 CCTTTTCCTCAGGCAGGAAAGGG + Intronic
1122829657 14:104389605-104389627 CCTTCTCTCCAGGAAGGCCAGGG - Intergenic
1202904404 14_GL000194v1_random:60040-60062 CCTGTGCTGTAGGAAGGGCATGG - Intergenic
1125766211 15:42138220-42138242 AATTTTCTCCATGAAGGACAGGG - Intergenic
1127998274 15:64168067-64168089 CCTTTTCTGGCTGATGGACAGGG + Exonic
1128234652 15:66059348-66059370 CCTCTTCTGCAGGAATGCTATGG - Intronic
1130042281 15:80415039-80415061 CCTTGCCTGCAGGAAAGAAATGG - Intronic
1130063930 15:80589537-80589559 CCTGTGCTGAAGGAAGGGCATGG - Intronic
1130854535 15:87829950-87829972 AATTTTCTGCAGGAAGGTCAAGG - Intergenic
1131551943 15:93364808-93364830 GCTGTTCTGCAGAAAGGACCTGG + Intergenic
1132060445 15:98688101-98688123 ACCTTACTGAAGGAAGGACATGG + Intronic
1133964831 16:10523177-10523199 CCTTCCCTGCAGCCAGGACATGG + Intergenic
1134303931 16:13015216-13015238 CCTTTTGTGCTGCAATGACATGG + Intronic
1134433636 16:14235216-14235238 CCTTCTCTCCAGAAAGGTCAAGG - Intronic
1134541047 16:15065851-15065873 CCTTTACTGAAGGAGGGACACGG + Intronic
1135436499 16:22430395-22430417 CCTTTACTGAAGGAGGGACATGG + Intronic
1136263758 16:29101520-29101542 CCTTTACTGAAGGAGGGACAAGG - Intergenic
1136562642 16:31049372-31049394 CCCGTTCAGAAGGAAGGACAGGG - Intergenic
1136987455 16:35122515-35122537 CCTCTTCTACATGAAGTACAGGG + Intergenic
1137423568 16:48357163-48357185 CCTTTTGTGGAGGAGGGACCAGG + Exonic
1141349288 16:83278038-83278060 CCTATTCTCCAAGAAGGCCAAGG + Intronic
1141929896 16:87195382-87195404 CCTTTTCAGCAGGGTGGTCATGG + Intronic
1145796814 17:27660430-27660452 CCCTCTCAGCAGGAAGGACAGGG + Intergenic
1145800845 17:27683833-27683855 CCCTCTCAGCAGGAAAGACAGGG + Intergenic
1145811206 17:27765418-27765440 CCCTCTCAGCAGGAAGGACAGGG + Intronic
1146423453 17:32712140-32712162 CTTTGTCTGAAGGAAGGTCATGG + Exonic
1150277576 17:63909776-63909798 CCACTGCTTCAGGAAGGACATGG - Exonic
1151169991 17:72237766-72237788 CCTGTTCCACAGGAAGGAAATGG - Intergenic
1151175288 17:72283389-72283411 CCTCTTCTGCAAGAAGAAGATGG - Intergenic
1151181121 17:72329469-72329491 CATGTTCTGCAGGAAGGGCTGGG - Intergenic
1151778987 17:76229622-76229644 CCTTTTCTTCTGGAAGGAGGAGG + Intronic
1151836867 17:76587571-76587593 CCTTTTCTCCATGAAGTAGAGGG - Intergenic
1152387970 17:79986518-79986540 CCTTTTCTGGTGGAAGGTCCTGG - Intronic
1152581754 17:81168428-81168450 CCCCTTCTCCAGGAAGCACAGGG + Intergenic
1153498235 18:5721863-5721885 GCTTTACTGAAGGAAGAACAGGG + Intergenic
1153668216 18:7385342-7385364 CGCTTTCTGCAAGAATGACAAGG + Intergenic
1153734932 18:8056956-8056978 TCTTTTCTGCAGTAAGGGAATGG + Intronic
1154023555 18:10685908-10685930 CCCTTTCTGCAGGATGGTGATGG + Intronic
1156174522 18:34527500-34527522 CCTTCTCTGTAGGAGGCACAGGG - Intronic
1157112893 18:44837652-44837674 CATTTGCTGCAGGAAGGAGCTGG + Intronic
1159436500 18:68425036-68425058 CATTTACTGCATGAAGGACTCGG - Intergenic
1159561858 18:70003914-70003936 CCTTTTCAACAGAAAGGAAAAGG + Exonic
1161210502 19:3062865-3062887 CCTTTTCTGCAGAAAGGCAGCGG + Exonic
1161767569 19:6215910-6215932 CCTTTTCCCCAGGAGGCACAGGG - Intronic
1162851708 19:13436134-13436156 CTGTTTCTTCAGAAAGGACAAGG + Intronic
1165223823 19:34339890-34339912 GCTTCTCTGCAGCAGGGACATGG - Exonic
1165421465 19:35724057-35724079 TCTTTTGTGTAGGAGGGACAAGG + Intronic
1165483777 19:36083046-36083068 CAGGGTCTGCAGGAAGGACAGGG - Exonic
1165808712 19:38597374-38597396 CCTATTCTCCAGGAAGAACATGG - Exonic
1166976506 19:46608102-46608124 CCTTCCCTGGAGGAAGGCCAAGG - Intronic
1167520060 19:49949344-49949366 CCTCTTCTGAAGGAAGAGCATGG + Exonic
1168578432 19:57533499-57533521 CCCTCTCTGCTGGAAGCACAAGG + Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925975775 2:9141016-9141038 CCATATTTGCAGGAAGTACATGG + Intergenic
928024806 2:27730650-27730672 CCTTTTCTCTAGGGAGGAAATGG - Intergenic
928142865 2:28745658-28745680 GCTCTTGTGCAGGAAGGAGAGGG + Intergenic
929401992 2:41594465-41594487 CCTTTTGTGCAAAATGGACAGGG - Intergenic
929479949 2:42296184-42296206 CCTACTCTGAAGGAAGTACATGG - Intronic
929581129 2:43082385-43082407 CCTGTTCACCAGGAAGGAAATGG - Intergenic
929751116 2:44714699-44714721 CCTTTTAAGCAAGTAGGACATGG + Intronic
931324282 2:61202223-61202245 CCTTTTCCATAGGAAGGAGAGGG + Intronic
934751463 2:96796752-96796774 GTTTTTGTGGAGGAAGGACAGGG - Intronic
934754903 2:96817989-96818011 CCTTATCTGCAGTAACGCCAGGG - Intronic
935815681 2:106843831-106843853 CCTGGTCTCCAGGAAGGAGAGGG + Exonic
941759814 2:169229426-169229448 CCTTCCCTGGAGCAAGGACAAGG + Intronic
942123332 2:172800306-172800328 CCAGTTCTGAAGGTAGGACATGG + Intronic
945447856 2:209959499-209959521 CATTTACTGGAGGAAGGGCAAGG + Exonic
1169722568 20:8694978-8695000 TCTTTTCTGCATTAGGGACAAGG - Intronic
1170562955 20:17572831-17572853 CCTTTTGTACAGGAAAAACAGGG + Intronic
1170822407 20:19765756-19765778 CCTTTTATGAAGTAAGCACAGGG + Intergenic
1172602170 20:36191269-36191291 CCTTATCTGCTGGGAGGCCAGGG + Intronic
1172609056 20:36235962-36235984 CTTGGCCTGCAGGAAGGACACGG + Intergenic
1172905250 20:38364301-38364323 CCTTTTCTGCATGATGGGCAAGG - Intronic
1174969726 20:55261139-55261161 CCATTTCTGCAGTAATGCCAGGG - Intergenic
1175410344 20:58763576-58763598 CCTTTTATGAATGAAGGAAAAGG - Intergenic
1175871553 20:62211704-62211726 CCTTTCCTACAGGACGGAAATGG + Intergenic
1176100026 20:63360647-63360669 CCTTTTCTGCAGGAAGGACAAGG - Intronic
1176623772 21:9074807-9074829 CCTGTGCTGTAGGAAGGGCATGG - Intergenic
1179445295 21:41426525-41426547 CCTCTCCTGCAGGAAGGCCGCGG - Intronic
1180099385 21:45577354-45577376 ACTTTTCGGCAGGAAGAAGAGGG + Intergenic
1180466370 22:15615285-15615307 CCCCCTCAGCAGGAAGGACAGGG + Intergenic
1180835248 22:18926478-18926500 AGGCTTCTGCAGGAAGGACAGGG - Intronic
1181466346 22:23112606-23112628 CCCCTTCTCCAGCAAGGACAGGG + Intronic
1182293734 22:29301017-29301039 CCCTTTCTACAGGAAGCACATGG + Intergenic
1183482034 22:38070503-38070525 CCTCTAGCGCAGGAAGGACATGG - Intronic
1184397264 22:44249680-44249702 CGTTTTCTGGAGGAAATACAAGG + Exonic
1184951330 22:47844521-47844543 CCTCCTGTGCAGGAGGGACAGGG + Intergenic
1184970917 22:48019262-48019284 GCTTTTCTGCACAAAGGAGAGGG + Intergenic
1203285336 22_KI270734v1_random:151777-151799 AGGCTTCTGCAGGAAGGACAGGG - Intergenic
949249781 3:1969886-1969908 TCATTTCTGAAGGAATGACAGGG + Intergenic
949337940 3:2997030-2997052 CCTTTACTGAAGGAAAGAAATGG + Intronic
950107608 3:10398277-10398299 CCTTGTGGGCAGGAAGGAGAGGG - Intronic
952196494 3:31081055-31081077 CCTTTTCAGAAGGAGAGACAAGG + Intergenic
952393250 3:32898937-32898959 CCATTTCTGAAGGAAGTGCAGGG + Intergenic
952751986 3:36832088-36832110 CCTGTTTAGCAAGAAGGACAAGG - Exonic
953850632 3:46463507-46463529 CCCTTTCCTCAGGAAGGACAAGG + Intronic
953873322 3:46646632-46646654 TGTTTTCTGCAGGAAGGAATGGG + Intergenic
954962750 3:54580641-54580663 TATTTTCTGCAGCAAGCACAGGG - Intronic
955105115 3:55890631-55890653 CCATTTCAGCAAGAAGCACATGG + Intronic
955930660 3:64053631-64053653 ATTTTTCAGCAGCAAGGACAGGG + Intergenic
955951031 3:64242225-64242247 CTTTTTCTGAAAGAAGGAAAAGG + Intronic
956750086 3:72338099-72338121 CCTATTCATCAGGAAGGATAGGG - Intergenic
958181126 3:90062200-90062222 GCTTTGCTGCAGGAAGTAGAGGG - Intergenic
960052294 3:113250538-113250560 CCTCGTCTGGAGGAAGAACAGGG - Exonic
961369009 3:126418441-126418463 TCTTTTCTGCTGGAAGAAGAGGG - Exonic
962074098 3:132062624-132062646 CCTTTCCTGCAGGAACGATCTGG - Intronic
964228050 3:154429734-154429756 CATTTTCTGCAGGACTGACAAGG - Intergenic
965124802 3:164612404-164612426 CCTTTTTTGCAGGAAGAAAAAGG - Intergenic
966185187 3:177220856-177220878 CCTTCCATTCAGGAAGGACATGG + Intergenic
967294808 3:187954571-187954593 TCTTTTCACCAGAAAGGACAAGG + Intergenic
967669266 3:192213020-192213042 GTTTTGCTGCAGGAAGAACATGG - Intronic
968755082 4:2411557-2411579 CCTTTCCTGCAGGAAGGCACTGG - Intronic
968768860 4:2490457-2490479 CCTTTTCTGTAGGAAAGGAAAGG + Exonic
968953585 4:3707115-3707137 CCCTTTCTGAAGGAGGGACGTGG - Intergenic
969570753 4:8006785-8006807 CCTCATCTGCAGGCAGGGCAAGG - Intronic
969574872 4:8030906-8030928 GCTGTTCTGCTGGAAGAACATGG - Intronic
969722505 4:8900331-8900353 CCGTCTCTGCAGGGAGGTCAGGG - Intergenic
970273377 4:14370217-14370239 CCTTTCCACCAGGAAGGACCAGG + Intergenic
971328675 4:25664709-25664731 CCCTTGCTGGGGGAAGGACAGGG + Intronic
972395216 4:38653125-38653147 CCTTTTCTGCACTAAAGATAAGG - Intergenic
972982552 4:44723895-44723917 CCTTATCTGCATGAAGGATTTGG + Intronic
973567004 4:52198894-52198916 TTTTTTTTGCAGGAAGGAAAGGG - Intergenic
974074320 4:57154917-57154939 CCTTTACAGAAGGAAGGAAAGGG - Intergenic
974617580 4:64308522-64308544 CCTTTTATGTGGGAAAGACAAGG - Intronic
975660401 4:76682823-76682845 CCTTGTCTCCAGGAAAGAAAAGG + Intronic
977430412 4:96925608-96925630 CCTTTTCTGCCAGAAGGAAGAGG + Intergenic
979053035 4:115958825-115958847 CTTTTGCACCAGGAAGGACAAGG - Intergenic
980311185 4:131131161-131131183 CCTTTGATGCATGAAGCACATGG - Intergenic
980800627 4:137744774-137744796 GCTTTTATGCAGCAAGTACAAGG - Intergenic
982084173 4:151817345-151817367 GCTTTTCTGGGGGAGGGACAAGG - Intergenic
982692356 4:158562973-158562995 TCATTTCTTTAGGAAGGACAAGG + Intronic
983583882 4:169335801-169335823 CCTTTTCATCAGTTAGGACAGGG - Intergenic
984211201 4:176850861-176850883 CCTTTTCTGTTGGAAGAAAATGG + Intergenic
984504410 4:180598861-180598883 GCTTGACTGCAGGAATGACATGG - Intergenic
985094659 4:186401624-186401646 GATTTTCTGCAGGCAGAACATGG - Intergenic
985891587 5:2720006-2720028 CCTTTTCTCCCTCAAGGACATGG - Intergenic
986245383 5:6002320-6002342 CCCTTTTTGAAGGAAGGAGAAGG - Intergenic
987474599 5:18375138-18375160 TCTTTTCTGAAGGGAGGCCAGGG + Intergenic
987924350 5:24320786-24320808 TCTTTGCTACAGGATGGACATGG + Intergenic
991175799 5:63686533-63686555 CCTCTTCAGCAGGAAGTAGATGG - Intergenic
995963301 5:117872229-117872251 CCATTTCTGCAGAATGGTCAGGG + Intergenic
996078915 5:119232568-119232590 CCCTTTTTACAGGAAGGAAATGG + Intronic
997015113 5:129923642-129923664 GCTTTTCTGCAGGAAAGAGTAGG + Intronic
997520851 5:134524239-134524261 CCTTCTCTCGAGGAAGGAGAAGG - Intergenic
997748930 5:136326044-136326066 CCTTATCTGCATGAAGGATTTGG - Intronic
998527685 5:142857528-142857550 CCCTTGCTGCAGGAGGGACGAGG - Intronic
999088446 5:148913664-148913686 CTGCTTCTGAAGGAAGGACATGG - Intergenic
1000824681 5:166030531-166030553 GCTTTCCTGGAGGAAGGAAACGG + Intergenic
1001323093 5:170698962-170698984 CCTTTTCTGCAGAGAGGTCTGGG - Intronic
1001836971 5:174840795-174840817 GCTTCTCTGCAGGAAGAAGAGGG + Intergenic
1002617300 5:180463928-180463950 GCTCTGCTGCAGAAAGGACAGGG - Intergenic
1002794862 6:464082-464104 CCTTTTCTGCACTTAGGAAAAGG + Intergenic
1006273298 6:32980879-32980901 CATTTACTGAAGGAGGGACATGG + Exonic
1006639284 6:35480820-35480842 CCCTTTTTGCGGGGAGGACAGGG - Intronic
1007679856 6:43626477-43626499 CCTGTTCTGCTGCAAGGACCAGG + Intronic
1010435315 6:75822802-75822824 CCTCTTCTGCAGGAAACACTTGG - Exonic
1013067884 6:106701162-106701184 CCTTTCCTGAAAGAAAGACATGG + Intergenic
1014199076 6:118588879-118588901 CCTTTTCAGCAGGAAGTAGCCGG + Intronic
1015069717 6:129076827-129076849 AATTTTCTGTAGGAAGGTCATGG + Intronic
1015162548 6:130169603-130169625 CCTTTGCTACAGAAAGAACAGGG - Intronic
1015220061 6:130794283-130794305 TGGTTTCTGCAGGAAAGACAAGG + Intergenic
1015404124 6:132818264-132818286 CCTTTTGTGCAGGAGCGAGAGGG + Intergenic
1016323213 6:142870709-142870731 ACTTTTCTGCTGGTAGAACAGGG - Intronic
1016839983 6:148516445-148516467 CCTGCTCTGCAAGATGGACAGGG - Intronic
1018178660 6:161201150-161201172 CATTTTCTCCAGAAAGGACCTGG - Intronic
1018750953 6:166805371-166805393 TCACTTCAGCAGGAAGGACAGGG - Intronic
1020894396 7:13921573-13921595 CCTTTTCTGTAGGCATGGCAAGG - Intronic
1021242115 7:18215767-18215789 TCTTTTCTTCAGGAAGACCAAGG - Intronic
1022964522 7:35460148-35460170 CCTTTTCTGCACAGAGGCCATGG - Intergenic
1024605523 7:51019635-51019657 CCTCTTCTGCAGGTAGAACGGGG - Intronic
1026738831 7:72965845-72965867 CCTTTTCTGCGAGAAGGACCAGG - Exonic
1026789840 7:73324475-73324497 CCTTTTCTGCGAGAAGGACCAGG - Exonic
1026979124 7:74516417-74516439 CTCTTCCTGCAGGAAAGACATGG - Intronic
1027104903 7:75399224-75399246 CCTTTTCTGCGAGAAGGACCAGG + Exonic
1027606177 7:80301714-80301736 CTTTTTCTTCAGGAATGACAGGG - Intergenic
1029801610 7:102953825-102953847 CATTTTCTGAAGGAAGGAAATGG - Intronic
1032090143 7:128907448-128907470 CTTATTCTGGAGGAAGGAGATGG + Exonic
1032515250 7:132502044-132502066 CCCTGTCAGCAGGAAGCACAGGG - Intronic
1034480233 7:151314197-151314219 CCTTTTCAGCAGTTAGGAGAGGG + Intergenic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1036281025 8:7401651-7401673 CCTTTTGTGTAGGAAGGGGAAGG - Intergenic
1036340440 8:7909921-7909943 CCTTTTGTGTAGGAAGGGGAAGG + Intergenic
1037461619 8:19116040-19116062 CCCTCTCTGCAGGAAGAAGAGGG + Intergenic
1037967296 8:23144839-23144861 CCGAGGCTGCAGGAAGGACAGGG + Intronic
1038654365 8:29435790-29435812 CATTTTCAGCAGGAAGAAGAAGG + Intergenic
1039461545 8:37749700-37749722 CTTTTTGTGCAGGAAGATCAAGG + Intronic
1039822507 8:41146368-41146390 CCTTATCTGCAGAAAGCACAAGG - Intergenic
1039971073 8:42322171-42322193 CCTGCTCTGGAGGAAGGACTGGG + Intronic
1040514647 8:48124834-48124856 CCATTTCTGCCAGAAGGGCAGGG - Intergenic
1042484188 8:69333471-69333493 CCTATGAGGCAGGAAGGACAGGG - Intergenic
1042949828 8:74189487-74189509 CCTGTTCTGCAGGAAGTTCGAGG - Intergenic
1043929612 8:86075685-86075707 CCTTTTCCTCAGCAAGGCCAAGG - Intronic
1044524700 8:93239503-93239525 CATTTTCTGCAGGACTGAGAAGG - Intergenic
1046518274 8:115291869-115291891 CCTTTTGTGCAGGAATGCCAAGG + Intergenic
1047423821 8:124728075-124728097 CCTCTTCTGCAGCGAGGACGGGG + Exonic
1048243607 8:132768779-132768801 CCCCTTCTGCAGGAGGGAGAGGG - Intergenic
1048307702 8:133295681-133295703 ACATTTCTGCAGCAAGAACAGGG + Intronic
1051994598 9:23200139-23200161 CCTTTTCTCCAGAGAGGAAATGG + Intergenic
1052083230 9:24232473-24232495 ACTTTCCTGCATGAAGGTCAGGG + Intergenic
1052982998 9:34462417-34462439 CCCTTTCTGGAGGCAGGATAGGG + Intronic
1053023168 9:34709549-34709571 CCAGGGCTGCAGGAAGGACAGGG - Exonic
1055931003 9:81559850-81559872 CCTTCTCTGTAGGGAGGAGAGGG - Intergenic
1056622209 9:88223912-88223934 CTTTTGCTGCAGGAAGGTGAAGG - Intergenic
1057261125 9:93585381-93585403 CCTTTTGTGGAGCAAGGCCAGGG + Intronic
1057747900 9:97766392-97766414 CCTTCTGTGCAGGAAAGGCAGGG + Intergenic
1057807351 9:98229030-98229052 TCTTTTCTGAAGGAATCACACGG - Exonic
1057908541 9:99000930-99000952 CCTTTTCTTCAGCAATGTCAAGG - Exonic
1058227982 9:102390636-102390658 CTCTTTCTGCAGCAAGGGCAGGG - Intergenic
1058256024 9:102764912-102764934 CCTTTCCTGTAGGAAGTACAAGG + Intergenic
1059172154 9:112135792-112135814 CCTTTTCTGCACTAGGCACAGGG + Intronic
1059897185 9:118879332-118879354 CCAATTCTGCTGGTAGGACATGG - Intergenic
1060112229 9:120914471-120914493 CCTGTTTTGAAGGAAGGTCATGG - Intronic
1060150006 9:121282423-121282445 CCTTTTCTGCCAAAAGGAGAAGG + Intronic
1061226855 9:129285379-129285401 CCTTTTCATCAGGAGGGACCTGG + Intergenic
1203794093 EBV:167059-167081 ACTTTTATACAGTAAGGACAAGG + Intergenic
1203563148 Un_KI270744v1:74245-74267 CCTGTGCTGTAGGAAGGACATGG + Intergenic
1185722348 X:2392150-2392172 CCATTTCCCCAGGAAGGACCAGG - Intronic
1189995186 X:46631089-46631111 CCTTTTCTCCATGAAGTCCACGG - Intronic
1190579414 X:51876534-51876556 CTTTTTCTTGAGGAAGGAGAGGG - Intronic
1192837220 X:74813394-74813416 TCTTTTCTAAAGGAAGGACCTGG - Intronic
1193757996 X:85432291-85432313 CATTTACTTCAGGAAGCACAGGG + Intergenic
1196084899 X:111674277-111674299 CTTTTTGTGCATGAAGGAGAGGG - Intronic
1201160282 Y:11160249-11160271 CCTGTGCTGTAGGAAGGGCATGG - Intergenic