ID: 1176100682

View in Genome Browser
Species Human (GRCh38)
Location 20:63363098-63363120
Sequence CAGGGTCTTGCACTGCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176100682_1176100690 9 Left 1176100682 20:63363098-63363120 CCCCTGGGCAGTGCAAGACCCTG No data
Right 1176100690 20:63363130-63363152 GCCTACATGAAGCCCCTCCATGG No data
1176100682_1176100697 26 Left 1176100682 20:63363098-63363120 CCCCTGGGCAGTGCAAGACCCTG No data
Right 1176100697 20:63363147-63363169 CCATGGGCCAGTTCTGTGCCAGG No data
1176100682_1176100692 10 Left 1176100682 20:63363098-63363120 CCCCTGGGCAGTGCAAGACCCTG No data
Right 1176100692 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176100682 Original CRISPR CAGGGTCTTGCACTGCCCAG GGG (reversed) Intronic