ID: 1176100685

View in Genome Browser
Species Human (GRCh38)
Location 20:63363100-63363122
Sequence ACCAGGGTCTTGCACTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176100685_1176100690 7 Left 1176100685 20:63363100-63363122 CCTGGGCAGTGCAAGACCCTGGT No data
Right 1176100690 20:63363130-63363152 GCCTACATGAAGCCCCTCCATGG No data
1176100685_1176100692 8 Left 1176100685 20:63363100-63363122 CCTGGGCAGTGCAAGACCCTGGT No data
Right 1176100692 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data
1176100685_1176100697 24 Left 1176100685 20:63363100-63363122 CCTGGGCAGTGCAAGACCCTGGT No data
Right 1176100697 20:63363147-63363169 CCATGGGCCAGTTCTGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176100685 Original CRISPR ACCAGGGTCTTGCACTGCCC AGG (reversed) Intronic