ID: 1176100688

View in Genome Browser
Species Human (GRCh38)
Location 20:63363117-63363139
Sequence TCATGTAGGCCAGAAGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176100688_1176100699 17 Left 1176100688 20:63363117-63363139 CCTGGTCCTTCTGGCCTACATGA No data
Right 1176100699 20:63363157-63363179 GTTCTGTGCCAGGAACTAGAAGG No data
1176100688_1176100697 7 Left 1176100688 20:63363117-63363139 CCTGGTCCTTCTGGCCTACATGA No data
Right 1176100697 20:63363147-63363169 CCATGGGCCAGTTCTGTGCCAGG No data
1176100688_1176100701 28 Left 1176100688 20:63363117-63363139 CCTGGTCCTTCTGGCCTACATGA No data
Right 1176100701 20:63363168-63363190 GGAACTAGAAGGTTCCAAGCTGG No data
1176100688_1176100690 -10 Left 1176100688 20:63363117-63363139 CCTGGTCCTTCTGGCCTACATGA No data
Right 1176100690 20:63363130-63363152 GCCTACATGAAGCCCCTCCATGG No data
1176100688_1176100692 -9 Left 1176100688 20:63363117-63363139 CCTGGTCCTTCTGGCCTACATGA No data
Right 1176100692 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176100688 Original CRISPR TCATGTAGGCCAGAAGGACC AGG (reversed) Intronic