ID: 1176100689

View in Genome Browser
Species Human (GRCh38)
Location 20:63363123-63363145
Sequence GGGGCTTCATGTAGGCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176100689_1176100699 11 Left 1176100689 20:63363123-63363145 CCTTCTGGCCTACATGAAGCCCC No data
Right 1176100699 20:63363157-63363179 GTTCTGTGCCAGGAACTAGAAGG No data
1176100689_1176100702 26 Left 1176100689 20:63363123-63363145 CCTTCTGGCCTACATGAAGCCCC No data
Right 1176100702 20:63363172-63363194 CTAGAAGGTTCCAAGCTGGATGG No data
1176100689_1176100697 1 Left 1176100689 20:63363123-63363145 CCTTCTGGCCTACATGAAGCCCC No data
Right 1176100697 20:63363147-63363169 CCATGGGCCAGTTCTGTGCCAGG No data
1176100689_1176100701 22 Left 1176100689 20:63363123-63363145 CCTTCTGGCCTACATGAAGCCCC No data
Right 1176100701 20:63363168-63363190 GGAACTAGAAGGTTCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176100689 Original CRISPR GGGGCTTCATGTAGGCCAGA AGG (reversed) Intronic