ID: 1176100691

View in Genome Browser
Species Human (GRCh38)
Location 20:63363131-63363153
Sequence CCCATGGAGGGGCTTCATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176100691_1176100699 3 Left 1176100691 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data
Right 1176100699 20:63363157-63363179 GTTCTGTGCCAGGAACTAGAAGG No data
1176100691_1176100702 18 Left 1176100691 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data
Right 1176100702 20:63363172-63363194 CTAGAAGGTTCCAAGCTGGATGG No data
1176100691_1176100697 -7 Left 1176100691 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data
Right 1176100697 20:63363147-63363169 CCATGGGCCAGTTCTGTGCCAGG No data
1176100691_1176100704 27 Left 1176100691 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data
Right 1176100704 20:63363181-63363203 TCCAAGCTGGATGGATATTTGGG No data
1176100691_1176100701 14 Left 1176100691 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data
Right 1176100701 20:63363168-63363190 GGAACTAGAAGGTTCCAAGCTGG No data
1176100691_1176100703 26 Left 1176100691 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data
Right 1176100703 20:63363180-63363202 TTCCAAGCTGGATGGATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176100691 Original CRISPR CCCATGGAGGGGCTTCATGT AGG (reversed) Intronic