ID: 1176100692

View in Genome Browser
Species Human (GRCh38)
Location 20:63363131-63363153
Sequence CCTACATGAAGCCCCTCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176100682_1176100692 10 Left 1176100682 20:63363098-63363120 CCCCTGGGCAGTGCAAGACCCTG No data
Right 1176100692 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data
1176100681_1176100692 15 Left 1176100681 20:63363093-63363115 CCAAGCCCCTGGGCAGTGCAAGA No data
Right 1176100692 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data
1176100677_1176100692 26 Left 1176100677 20:63363082-63363104 CCTTGCTCTTCCCAAGCCCCTGG No data
Right 1176100692 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data
1176100688_1176100692 -9 Left 1176100688 20:63363117-63363139 CCTGGTCCTTCTGGCCTACATGA No data
Right 1176100692 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data
1176100685_1176100692 8 Left 1176100685 20:63363100-63363122 CCTGGGCAGTGCAAGACCCTGGT No data
Right 1176100692 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data
1176100680_1176100692 16 Left 1176100680 20:63363092-63363114 CCCAAGCCCCTGGGCAGTGCAAG No data
Right 1176100692 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data
1176100683_1176100692 9 Left 1176100683 20:63363099-63363121 CCCTGGGCAGTGCAAGACCCTGG No data
Right 1176100692 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data
1176100687_1176100692 -8 Left 1176100687 20:63363116-63363138 CCCTGGTCCTTCTGGCCTACATG No data
Right 1176100692 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176100692 Original CRISPR CCTACATGAAGCCCCTCCAT GGG Intronic