ID: 1176100697

View in Genome Browser
Species Human (GRCh38)
Location 20:63363147-63363169
Sequence CCATGGGCCAGTTCTGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176100685_1176100697 24 Left 1176100685 20:63363100-63363122 CCTGGGCAGTGCAAGACCCTGGT No data
Right 1176100697 20:63363147-63363169 CCATGGGCCAGTTCTGTGCCAGG No data
1176100689_1176100697 1 Left 1176100689 20:63363123-63363145 CCTTCTGGCCTACATGAAGCCCC No data
Right 1176100697 20:63363147-63363169 CCATGGGCCAGTTCTGTGCCAGG No data
1176100688_1176100697 7 Left 1176100688 20:63363117-63363139 CCTGGTCCTTCTGGCCTACATGA No data
Right 1176100697 20:63363147-63363169 CCATGGGCCAGTTCTGTGCCAGG No data
1176100683_1176100697 25 Left 1176100683 20:63363099-63363121 CCCTGGGCAGTGCAAGACCCTGG No data
Right 1176100697 20:63363147-63363169 CCATGGGCCAGTTCTGTGCCAGG No data
1176100687_1176100697 8 Left 1176100687 20:63363116-63363138 CCCTGGTCCTTCTGGCCTACATG No data
Right 1176100697 20:63363147-63363169 CCATGGGCCAGTTCTGTGCCAGG No data
1176100682_1176100697 26 Left 1176100682 20:63363098-63363120 CCCCTGGGCAGTGCAAGACCCTG No data
Right 1176100697 20:63363147-63363169 CCATGGGCCAGTTCTGTGCCAGG No data
1176100691_1176100697 -7 Left 1176100691 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data
Right 1176100697 20:63363147-63363169 CCATGGGCCAGTTCTGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176100697 Original CRISPR CCATGGGCCAGTTCTGTGCC AGG Intronic