ID: 1176100699

View in Genome Browser
Species Human (GRCh38)
Location 20:63363157-63363179
Sequence GTTCTGTGCCAGGAACTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176100691_1176100699 3 Left 1176100691 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data
Right 1176100699 20:63363157-63363179 GTTCTGTGCCAGGAACTAGAAGG No data
1176100687_1176100699 18 Left 1176100687 20:63363116-63363138 CCCTGGTCCTTCTGGCCTACATG No data
Right 1176100699 20:63363157-63363179 GTTCTGTGCCAGGAACTAGAAGG No data
1176100688_1176100699 17 Left 1176100688 20:63363117-63363139 CCTGGTCCTTCTGGCCTACATGA No data
Right 1176100699 20:63363157-63363179 GTTCTGTGCCAGGAACTAGAAGG No data
1176100693_1176100699 -8 Left 1176100693 20:63363142-63363164 CCCCTCCATGGGCCAGTTCTGTG No data
Right 1176100699 20:63363157-63363179 GTTCTGTGCCAGGAACTAGAAGG No data
1176100694_1176100699 -9 Left 1176100694 20:63363143-63363165 CCCTCCATGGGCCAGTTCTGTGC No data
Right 1176100699 20:63363157-63363179 GTTCTGTGCCAGGAACTAGAAGG No data
1176100689_1176100699 11 Left 1176100689 20:63363123-63363145 CCTTCTGGCCTACATGAAGCCCC No data
Right 1176100699 20:63363157-63363179 GTTCTGTGCCAGGAACTAGAAGG No data
1176100695_1176100699 -10 Left 1176100695 20:63363144-63363166 CCTCCATGGGCCAGTTCTGTGCC No data
Right 1176100699 20:63363157-63363179 GTTCTGTGCCAGGAACTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176100699 Original CRISPR GTTCTGTGCCAGGAACTAGA AGG Intronic