ID: 1176100701

View in Genome Browser
Species Human (GRCh38)
Location 20:63363168-63363190
Sequence GGAACTAGAAGGTTCCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176100693_1176100701 3 Left 1176100693 20:63363142-63363164 CCCCTCCATGGGCCAGTTCTGTG No data
Right 1176100701 20:63363168-63363190 GGAACTAGAAGGTTCCAAGCTGG No data
1176100694_1176100701 2 Left 1176100694 20:63363143-63363165 CCCTCCATGGGCCAGTTCTGTGC No data
Right 1176100701 20:63363168-63363190 GGAACTAGAAGGTTCCAAGCTGG No data
1176100691_1176100701 14 Left 1176100691 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data
Right 1176100701 20:63363168-63363190 GGAACTAGAAGGTTCCAAGCTGG No data
1176100695_1176100701 1 Left 1176100695 20:63363144-63363166 CCTCCATGGGCCAGTTCTGTGCC No data
Right 1176100701 20:63363168-63363190 GGAACTAGAAGGTTCCAAGCTGG No data
1176100689_1176100701 22 Left 1176100689 20:63363123-63363145 CCTTCTGGCCTACATGAAGCCCC No data
Right 1176100701 20:63363168-63363190 GGAACTAGAAGGTTCCAAGCTGG No data
1176100687_1176100701 29 Left 1176100687 20:63363116-63363138 CCCTGGTCCTTCTGGCCTACATG No data
Right 1176100701 20:63363168-63363190 GGAACTAGAAGGTTCCAAGCTGG No data
1176100688_1176100701 28 Left 1176100688 20:63363117-63363139 CCTGGTCCTTCTGGCCTACATGA No data
Right 1176100701 20:63363168-63363190 GGAACTAGAAGGTTCCAAGCTGG No data
1176100696_1176100701 -2 Left 1176100696 20:63363147-63363169 CCATGGGCCAGTTCTGTGCCAGG No data
Right 1176100701 20:63363168-63363190 GGAACTAGAAGGTTCCAAGCTGG No data
1176100698_1176100701 -9 Left 1176100698 20:63363154-63363176 CCAGTTCTGTGCCAGGAACTAGA No data
Right 1176100701 20:63363168-63363190 GGAACTAGAAGGTTCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176100701 Original CRISPR GGAACTAGAAGGTTCCAAGC TGG Intronic