ID: 1176100702

View in Genome Browser
Species Human (GRCh38)
Location 20:63363172-63363194
Sequence CTAGAAGGTTCCAAGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176100693_1176100702 7 Left 1176100693 20:63363142-63363164 CCCCTCCATGGGCCAGTTCTGTG No data
Right 1176100702 20:63363172-63363194 CTAGAAGGTTCCAAGCTGGATGG No data
1176100695_1176100702 5 Left 1176100695 20:63363144-63363166 CCTCCATGGGCCAGTTCTGTGCC No data
Right 1176100702 20:63363172-63363194 CTAGAAGGTTCCAAGCTGGATGG No data
1176100696_1176100702 2 Left 1176100696 20:63363147-63363169 CCATGGGCCAGTTCTGTGCCAGG No data
Right 1176100702 20:63363172-63363194 CTAGAAGGTTCCAAGCTGGATGG No data
1176100694_1176100702 6 Left 1176100694 20:63363143-63363165 CCCTCCATGGGCCAGTTCTGTGC No data
Right 1176100702 20:63363172-63363194 CTAGAAGGTTCCAAGCTGGATGG No data
1176100689_1176100702 26 Left 1176100689 20:63363123-63363145 CCTTCTGGCCTACATGAAGCCCC No data
Right 1176100702 20:63363172-63363194 CTAGAAGGTTCCAAGCTGGATGG No data
1176100698_1176100702 -5 Left 1176100698 20:63363154-63363176 CCAGTTCTGTGCCAGGAACTAGA No data
Right 1176100702 20:63363172-63363194 CTAGAAGGTTCCAAGCTGGATGG No data
1176100691_1176100702 18 Left 1176100691 20:63363131-63363153 CCTACATGAAGCCCCTCCATGGG No data
Right 1176100702 20:63363172-63363194 CTAGAAGGTTCCAAGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176100702 Original CRISPR CTAGAAGGTTCCAAGCTGGA TGG Intronic