ID: 1176102430

View in Genome Browser
Species Human (GRCh38)
Location 20:63370549-63370571
Sequence CACCCACCAAGGACCCAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 282}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176102430_1176102441 25 Left 1176102430 20:63370549-63370571 CCGGCCTGGGTCCTTGGTGGGTG 0: 1
1: 0
2: 2
3: 41
4: 282
Right 1176102441 20:63370597-63370619 GACTTTGCCCCCTGAGCAGGAGG 0: 1
1: 0
2: 0
3: 31
4: 687
1176102430_1176102436 3 Left 1176102430 20:63370549-63370571 CCGGCCTGGGTCCTTGGTGGGTG 0: 1
1: 0
2: 2
3: 41
4: 282
Right 1176102436 20:63370575-63370597 GAGTGCCAGCTTGCCCTCACGGG 0: 1
1: 0
2: 0
3: 9
4: 133
1176102430_1176102435 2 Left 1176102430 20:63370549-63370571 CCGGCCTGGGTCCTTGGTGGGTG 0: 1
1: 0
2: 2
3: 41
4: 282
Right 1176102435 20:63370574-63370596 TGAGTGCCAGCTTGCCCTCACGG 0: 1
1: 0
2: 1
3: 15
4: 165
1176102430_1176102440 22 Left 1176102430 20:63370549-63370571 CCGGCCTGGGTCCTTGGTGGGTG 0: 1
1: 0
2: 2
3: 41
4: 282
Right 1176102440 20:63370594-63370616 CGGGACTTTGCCCCCTGAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 86
1176102430_1176102442 26 Left 1176102430 20:63370549-63370571 CCGGCCTGGGTCCTTGGTGGGTG 0: 1
1: 0
2: 2
3: 41
4: 282
Right 1176102442 20:63370598-63370620 ACTTTGCCCCCTGAGCAGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176102430 Original CRISPR CACCCACCAAGGACCCAGGC CGG (reversed) Intronic
900104161 1:975280-975302 CCCCCACCCAGCACCCAGCCAGG + Exonic
900291852 1:1927068-1927090 CACCCACCATCGGCCCAGGCCGG + Intronic
900580017 1:3404289-3404311 CACACACCGAGGACGCAGGTCGG - Intronic
900586314 1:3433853-3433875 CAGCCACGAAGGACGGAGGCGGG + Exonic
900586933 1:3437120-3437142 CACACCCCAGGGCCCCAGGCAGG - Exonic
900672798 1:3866177-3866199 TACCCAGCAAGGACTCAGGTGGG + Intronic
900830971 1:4965120-4965142 CAGCCTCCAAGGTCCCAGGCTGG - Intergenic
901631191 1:10649003-10649025 CACCCACCCCAGAGCCAGGCTGG + Intronic
901769401 1:11522749-11522771 GACCCAGCCAGGACCCAGCCAGG + Intronic
901769405 1:11522760-11522782 GACCCAGCCAGGACCCAGCCAGG + Intronic
901769456 1:11522914-11522936 GACCCAGCAAGGACCCAGCCAGG + Intronic
902384049 1:16066332-16066354 ACCCCACCCATGACCCAGGCAGG + Intronic
902563015 1:17289685-17289707 CATCCACCAAGCACCCACACCGG - Intergenic
902941719 1:19804871-19804893 CACTCAACAAACACCCAGGCCGG - Intergenic
903347073 1:22693357-22693379 CTGTCACCCAGGACCCAGGCTGG - Intergenic
904012863 1:27399634-27399656 CACCCACATAGGACCAAGGGAGG - Intergenic
904037204 1:27565247-27565269 TACTCACCAAGGGGCCAGGCGGG - Intronic
904336248 1:29800290-29800312 CACCCACCCTGGGCCAAGGCGGG - Intergenic
904464299 1:30698768-30698790 CACCCACCCTGGCCCAAGGCGGG + Intergenic
905110120 1:35588712-35588734 CAGCCACCAGGGACCTGGGCCGG - Intronic
905352499 1:37357307-37357329 CACTTTCCAAGGACTCAGGCAGG + Intergenic
906669078 1:47641842-47641864 CACCCACAAACGAGCCAGGAGGG - Intergenic
907250805 1:53137783-53137805 CACAGACCAAGGCCCCAGGCAGG - Intronic
908751576 1:67429658-67429680 CACCCGCCAAGGAATCCGGCGGG + Intronic
911824652 1:102466634-102466656 CACCCAGCAATGACACATGCAGG + Intergenic
912550651 1:110483326-110483348 CTCCCACCCAGGACCCAGGCAGG + Intergenic
913531998 1:119740253-119740275 CACCCACCAGGCACCAAGGCAGG + Intronic
914988609 1:152479765-152479787 CACCCACCAAGAAGCCTTGCAGG - Intergenic
922255066 1:223886569-223886591 CAGCCACCAAGCCCCCAGGTAGG - Intergenic
923975288 1:239255820-239255842 CACCCACCCGGAACCCAGGCTGG + Intergenic
1063942704 10:11146886-11146908 CACACACCAAGGCTACAGGCTGG - Intronic
1064055675 10:12095125-12095147 CTCTCACCAAGGTGCCAGGCAGG - Intronic
1066613626 10:37275640-37275662 CACCCACCCAGAACTCATGCTGG + Intronic
1067497401 10:46773386-46773408 CACCTAGCAAGGCCCCAGGCAGG - Intergenic
1067536595 10:47114957-47114979 CACCCCTCAAAGACACAGGCAGG + Intergenic
1067597250 10:47567029-47567051 CACCTAGCAAGGCCCCAGGCAGG + Intergenic
1067804699 10:49384680-49384702 CACCAACCCAGGACAGAGGCTGG - Intronic
1070140599 10:73734639-73734661 CACCTAGCAAGTCCCCAGGCAGG + Intergenic
1070190551 10:74108165-74108187 CACCCACCAAGCACCCAGCTGGG - Intronic
1070385188 10:75917857-75917879 CAAGCACCAAGTACCAAGGCGGG - Intronic
1071489102 10:86123925-86123947 CCCACACCAAGGGCCCATGCAGG + Intronic
1071565034 10:86667361-86667383 CTCCAACCAAGGAGCCAGGGTGG + Intergenic
1072813320 10:98480605-98480627 CTCCAACCAAGGATGCAGGCAGG - Intronic
1074516308 10:114173850-114173872 CGCCCTCAAAGGAGCCAGGCGGG + Intronic
1074721287 10:116267434-116267456 CTGCCACCCAGGGCCCAGGCTGG - Intronic
1075583371 10:123639298-123639320 AACCTACCAGGGACCCAGCCTGG + Intergenic
1075676562 10:124299960-124299982 CACCCACCAAGGCCAGAGGGAGG + Intergenic
1076426743 10:130372429-130372451 CCAGCACCAAGGACACAGGCTGG - Intergenic
1076554478 10:131312383-131312405 CGCCCTCCAAGGCACCAGGCAGG + Intergenic
1076800599 10:132826291-132826313 GACCCACCACAGAGCCAGGCAGG + Intronic
1076859218 10:133132708-133132730 CGCCCACGAAGGCCCCAGACAGG + Intergenic
1077170541 11:1164065-1164087 CCCCCACCGAGGACTCAGACGGG + Intronic
1077460231 11:2705447-2705469 CACCCAACCAGGCCCCAAGCAGG - Intronic
1078542554 11:12223510-12223532 CACCCACCAGGGTCCCAGGAGGG - Intronic
1078902546 11:15654791-15654813 CACCAACCCAGGAGGCAGGCAGG - Intergenic
1078919760 11:15818764-15818786 CATCCGCCAAGCACCCAGGTGGG + Intergenic
1079008459 11:16809466-16809488 CCCCCTCCAAGGAACCAGGGGGG + Intronic
1080757638 11:35217470-35217492 CAACCACCAAGGACACTGGAAGG + Intronic
1081488450 11:43548653-43548675 CACCCACCAAGGAACCATGAAGG - Intergenic
1081642513 11:44766012-44766034 CACCTACCAGCAACCCAGGCAGG - Intronic
1081779051 11:45697196-45697218 CACATATCCAGGACCCAGGCTGG - Intergenic
1082986437 11:59173761-59173783 CACCCCCCAAGGCCCCATCCTGG - Intronic
1083614594 11:64019960-64019982 CAGCCTCCTAGGGCCCAGGCAGG + Intronic
1084358186 11:68653004-68653026 CACCACCCAAGGACCCTGGCAGG - Intergenic
1084450483 11:69233828-69233850 CACCCCCCATGGAGCCTGGCTGG + Intergenic
1085387108 11:76163714-76163736 CCCTCACCAAGGCCCCTGGCGGG + Intergenic
1085516174 11:77113128-77113150 CCCCAACCAAGGCCCCAGGCAGG - Intronic
1088653566 11:111977999-111978021 CCCCCACCAAAGACCCTGGCAGG - Intronic
1089556873 11:119319944-119319966 CCCCCTCCAAAGACCCAGGCCGG - Intronic
1091166388 11:133479943-133479965 CACCACCCAAGGAGCCAGCCCGG + Intronic
1094525772 12:31229688-31229710 CACACACCAGAGCCCCAGGCTGG + Intergenic
1095478629 12:42611093-42611115 CACCCACCCAGAACTCATGCTGG + Intergenic
1096530801 12:52241665-52241687 CTGCCACCAAGGACCCTGGCAGG - Intronic
1099190936 12:79561585-79561607 CACCCACCCAGAACTCACGCTGG - Intergenic
1103872111 12:124099538-124099560 AACCCTCCAAGGACACAGGCAGG + Intronic
1105514629 13:21078138-21078160 CACACATCTTGGACCCAGGCTGG + Intergenic
1107144855 13:37049973-37049995 CACCCACCAAAGTCCCAGGAGGG + Intronic
1107715274 13:43193581-43193603 CACCTACCAATCAACCAGGCAGG - Intergenic
1116310983 14:43326649-43326671 CGCCCACCCAGGACTCACGCTGG - Intergenic
1116781394 14:49241246-49241268 CACCAACCAATGACACATGCAGG + Intergenic
1116888294 14:50241719-50241741 CTGTCACCCAGGACCCAGGCTGG - Intronic
1119043586 14:71297415-71297437 CACCCTCCAAGGCCCAAAGCAGG + Intergenic
1119227556 14:72955779-72955801 CTCACACCAAGACCCCAGGCAGG + Intronic
1119406221 14:74401358-74401380 CTCCCACTAAAGAGCCAGGCAGG - Intergenic
1119539891 14:75431115-75431137 CAGCCACCAAGGACCAGAGCTGG + Intronic
1121017290 14:90556444-90556466 CACCCACAGAAGACCCTGGCTGG - Intronic
1121525339 14:94615517-94615539 CAGACACCAAGGCCCCTGGCTGG - Intronic
1121791475 14:96702656-96702678 CACCAACCAAGCTACCAGGCAGG - Intergenic
1122514511 14:102297730-102297752 CACCCACCCAGAACTCATGCTGG - Intronic
1122601645 14:102924485-102924507 CACCCACCCAGGCCCCTCGCTGG - Intronic
1122873148 14:104650638-104650660 AACCAAACCAGGACCCAGGCAGG - Intergenic
1122967888 14:105139700-105139722 CGCCCACCATGGACACACGCAGG + Intergenic
1122970847 14:105151619-105151641 CACTCACCAAGGGCACAGGTGGG + Exonic
1122995583 14:105262099-105262121 CACCCACACAGGAGCCCGGCAGG + Intronic
1124110620 15:26781942-26781964 CGCCCACCCAGGACTCACGCTGG + Intronic
1124636704 15:31369859-31369881 CATCCACAAAGGAACAAGGCTGG - Intronic
1125294809 15:38191155-38191177 CACCCATGAAGGTCACAGGCTGG - Intergenic
1125315850 15:38430401-38430423 CACCTACCTAGGACCCATTCAGG + Intergenic
1125532118 15:40420495-40420517 CACTCTCCAAGGACACAAGCTGG - Intronic
1125714646 15:41812675-41812697 TAGCCACCAAGGCCCCTGGCAGG + Intronic
1125921385 15:43527745-43527767 CATCCCCCAAGGAATCAGGCCGG + Exonic
1127933366 15:63612604-63612626 CACCCACCAAGGGCCCTGTGGGG + Intronic
1129684385 15:77676955-77676977 CCCCCACCATGGCCCCTGGCAGG + Intronic
1130031130 15:80315254-80315276 CACCCTCAAAGGCCACAGGCAGG - Intergenic
1131009078 15:89002605-89002627 CTACCACCAAGGTCCCAGACAGG + Intergenic
1131178639 15:90225419-90225441 CACCCCCCAAGTACCCTGCCAGG - Intronic
1131692657 15:94844271-94844293 CCCCCACCCATGCCCCAGGCCGG - Intergenic
1132025110 15:98398755-98398777 CAGCCACCAAAGCCACAGGCTGG - Intergenic
1132515309 16:363273-363295 CACCCACCAGCCACCCAAGCTGG - Intergenic
1132606304 16:795172-795194 CACACACACAGCACCCAGGCTGG - Exonic
1132669847 16:1098085-1098107 CACCCAGCAGCGTCCCAGGCGGG + Intergenic
1132888144 16:2191437-2191459 CAGCAGCCAAGGACACAGGCTGG - Intronic
1132989535 16:2785771-2785793 CGCTCACCGAGGGCCCAGGCGGG - Intronic
1134017419 16:10898777-10898799 CACCCCCCAGGGAACAAGGCAGG - Intronic
1134298787 16:12971073-12971095 CACCCACCTGGGATCCTGGCAGG + Intronic
1136110104 16:28059345-28059367 GACCCATGCAGGACCCAGGCGGG - Intronic
1137256318 16:46778207-46778229 CACCCTCCAAGGCCCCAGGAAGG + Intronic
1137547093 16:49411764-49411786 CTGCCACCCTGGACCCAGGCAGG + Intergenic
1137720244 16:50623423-50623445 GACCCTACAAGGACCCAGGTGGG - Intronic
1138584155 16:57959887-57959909 CACCAACCAGGGACCCTGCCAGG - Exonic
1139429831 16:66905165-66905187 CACCCACCCAGGACTCTAGCTGG - Intergenic
1139496154 16:67320034-67320056 CAGCCACCATGGACCCAGAATGG - Intronic
1140603066 16:76501336-76501358 AACCCTGCAGGGACCCAGGCTGG + Intronic
1141546930 16:84776560-84776582 CACACTCCAAGGAGCCAGGCAGG - Intronic
1142429566 16:90019050-90019072 CACCCACCAAGGAGCGTGCCGGG + Intronic
1144776119 17:17785539-17785561 GAGCCACCAAGGAGCCTGGCGGG + Intronic
1144835497 17:18154618-18154640 CCCCCAGCTGGGACCCAGGCTGG - Intronic
1145274240 17:21420563-21420585 CACCCAGGAATGACTCAGGCAGG - Intergenic
1147667732 17:42159450-42159472 CGCCCACCATGAGCCCAGGCTGG - Intronic
1149486374 17:57046006-57046028 GACTCCCCAAGGACCCAGGCTGG - Intergenic
1151351826 17:73536466-73536488 CACCCTCCAAACCCCCAGGCTGG + Intronic
1151419097 17:73985681-73985703 CACCCAGGAAGGTCCCTGGCTGG - Intergenic
1151485803 17:74398761-74398783 CTGCCACCCAGGGCCCAGGCTGG - Intergenic
1151828350 17:76535986-76536008 CACCCTCCGAGGACGCAGTCTGG + Intronic
1152077406 17:78168243-78168265 CACCTACCAAGAACCCACCCAGG - Intergenic
1152209857 17:78997318-78997340 CCCCCACAAAGGACACCGGCTGG - Exonic
1152246397 17:79186885-79186907 CACCCTCCAAGGCCCCTGCCAGG - Intronic
1152318821 17:79596520-79596542 CACCCACCGTGGGCCCAGCCAGG + Intergenic
1152737262 17:82003700-82003722 CATGCACAAAGGACGCAGGCGGG - Intronic
1154281357 18:13005986-13006008 CACCCACAAGGGACTCAGACGGG - Intronic
1156229203 18:35137734-35137756 CACCCAGCAAGAACACACGCGGG + Intronic
1157147511 18:45179356-45179378 CTCCCACCATGGCCTCAGGCTGG + Intergenic
1157202370 18:45669805-45669827 CATCCACAAAGAGCCCAGGCTGG - Intronic
1160297017 18:77648037-77648059 CACCTACCTGTGACCCAGGCAGG - Intergenic
1160707550 19:536552-536574 CTCCCACCAGGACCCCAGGCCGG + Intronic
1160733047 19:649813-649835 CACTCACCAGGGGCCCAGGCTGG + Intronic
1160733065 19:649859-649881 TACTCACCAGGGACCCTGGCTGG + Intronic
1160733085 19:649905-649927 CACTCACCAGGGGCCCAGGCTGG + Intronic
1160733102 19:649951-649973 TACTCACCAGGGACCCTGGCTGG + Intronic
1160733122 19:649997-650019 CACTCACCAGGGGCCCAGGCTGG + Intronic
1160733142 19:650043-650065 CACTCACCAGGGGCCCAGGCTGG + Intronic
1160733161 19:650089-650111 TACTCACCAGGGGCCCAGGCTGG + Intronic
1160733179 19:650135-650157 TACTCACCAGGGACCCTGGCTGG + Intronic
1160733198 19:650181-650203 CACTCACCAGGGACCCAGGCTGG + Intronic
1160733218 19:650227-650249 CACTCACCAGGGGCCCAGGCTGG + Exonic
1160846124 19:1166894-1166916 CACTCCCCAAGGAGCCAGGTGGG - Intronic
1161041323 19:2112068-2112090 CACCGACCAGGGAGCCATGCAGG + Intronic
1161045516 19:2132355-2132377 CACGCACCGGGGACCCCGGCCGG + Intronic
1161320605 19:3639077-3639099 CCCCCACTCAGGACCCAGGCAGG + Intronic
1162584235 19:11549448-11549470 CACCAACAAAGGAGCCAGCCAGG + Exonic
1163167628 19:15508725-15508747 GACCCCCCCAGGACCCAGGACGG + Intronic
1163417552 19:17195645-17195667 CAGCCAGCCAGGGCCCAGGCTGG + Intronic
1164535853 19:29086229-29086251 CACCATCCCAGGAGCCAGGCTGG - Intergenic
1165319356 19:35075958-35075980 CCCTCCCCAAGGACCCAGGGAGG - Intergenic
1166878191 19:45911032-45911054 CACCCACAAAGAACCAGGGCAGG - Intergenic
1167392063 19:49202014-49202036 CACCCTCCTGGGGCCCAGGCGGG + Exonic
1167613286 19:50517514-50517536 CCCCCACCCAGGTCCCAGCCCGG - Exonic
927713412 2:25339511-25339533 GACCCACCAGGGAGGCAGGCAGG + Intronic
930661740 2:54061536-54061558 GTCCAACAAAGGACCCAGGCTGG - Intronic
934719569 2:96564200-96564222 CGCCCTCCAGGGAACCAGGCAGG - Intergenic
936401307 2:112166541-112166563 GACCCACCTAGGAACCAGTCAGG + Intronic
937259440 2:120576217-120576239 CACCTACCAGGGCCCCAGCCAGG - Intergenic
941655998 2:168145414-168145436 CTCCCACCAAGGTCCAAGGCAGG + Intronic
942937416 2:181575000-181575022 CAGCCTCCAATCACCCAGGCTGG + Intronic
944110966 2:196130790-196130812 CACCCATCAAGGAGCCACGCAGG - Intergenic
948293694 2:236845732-236845754 CACCCTCCAAGGAGCCAGTGGGG - Intergenic
948427062 2:237895044-237895066 CAGCCACCAAGGGCCCAGCAGGG + Intronic
1168981899 20:2011420-2011442 CAACCACCAAGATCCCAGGCTGG + Intergenic
1171240383 20:23562982-23563004 CACTGCCCCAGGACCCAGGCTGG - Intergenic
1172426672 20:34860303-34860325 CCCCCACCAAGAGCCCAGGCTGG + Exonic
1172661898 20:36573979-36574001 CCCCCACCAGGGCCCCAAGCGGG - Intronic
1173805807 20:45924600-45924622 AACCCAGCTGGGACCCAGGCTGG + Intergenic
1174038516 20:47682961-47682983 CATCCCCCAGGGACCCAGGGAGG - Intronic
1174059379 20:47821753-47821775 GATCCCCCAAGGACCCTGGCTGG - Intergenic
1174706471 20:52661394-52661416 CTCCCACCACTGACCCAGTCTGG - Intergenic
1175287201 20:57844854-57844876 TCCCCTCCAAGCACCCAGGCCGG + Intergenic
1175569792 20:60010111-60010133 CACTAAACAAGGGCCCAGGCAGG + Intronic
1175916630 20:62428836-62428858 CACTCACAAAGGGCCCAGCCAGG - Intergenic
1176102430 20:63370549-63370571 CACCCACCAAGGACCCAGGCCGG - Intronic
1176111217 20:63411593-63411615 CCTCCACCAGGGCCCCAGGCAGG - Intronic
1179109349 21:38433005-38433027 CAGCCACGAAGGAGCAAGGCAGG + Intronic
1179613323 21:42566176-42566198 GCCCCACCAAGGCCCCAGGAGGG - Intronic
1179828533 21:43981818-43981840 CTCCCACCAAGGCCCCTGGCAGG - Intronic
1179933256 21:44586058-44586080 CTCCATCCTAGGACCCAGGCTGG + Intronic
1179970734 21:44835822-44835844 CAGCCAGCAAGGTCCCTGGCTGG + Intergenic
1182468310 22:30531870-30531892 CACCCACCCATGCCCCTGGCGGG + Intronic
1183528627 22:38339365-38339387 AACCCAGAAAGGACCCAGGGAGG + Intronic
1183779522 22:39989867-39989889 CTCCCGCCATGTACCCAGGCAGG + Intergenic
1184730223 22:46367607-46367629 CCCCCACGCGGGACCCAGGCAGG + Intronic
1185011502 22:48317069-48317091 CAAGCACCAAGGACAAAGGCAGG + Intergenic
950142464 3:10624928-10624950 CCCCCACCATGGCACCAGGCTGG + Intronic
950377210 3:12581542-12581564 CACACAGCAAGTCCCCAGGCAGG + Intronic
950461155 3:13122915-13122937 CACGCTCCCAGGACACAGGCTGG + Intergenic
950851421 3:16065431-16065453 CACCAACCAAAGTCACAGGCAGG - Intergenic
951363884 3:21757164-21757186 CTCTCACCCAGGCCCCAGGCTGG + Intronic
952932732 3:38372771-38372793 CATCCAGCATGGACCCAGTCAGG - Intronic
953025629 3:39143352-39143374 CACCCAGCATGGACGCTGGCCGG - Exonic
953244469 3:41178122-41178144 CACCCACCAGGGATCCCAGCTGG - Intergenic
953606328 3:44415486-44415508 CACCCAGCACGGCCCCAGGCAGG + Intergenic
954162417 3:48732339-48732361 CACCCACCCAGGCTGCAGGCTGG - Intronic
954390437 3:50265565-50265587 CCCAGAGCAAGGACCCAGGCAGG + Intergenic
954603432 3:51890678-51890700 TACCCACCAAGGAGTAAGGCAGG - Intergenic
961465066 3:127076556-127076578 CGCCCACCCAGAACTCAGGCTGG + Intergenic
961530484 3:127537247-127537269 CACCCACCAGGAGCCCAGGGTGG + Intergenic
961681571 3:128603542-128603564 CACCTGCCAAGGCCCCACGCTGG + Intergenic
963061755 3:141231892-141231914 CACCGCCCATGGTCCCAGGCCGG - Exonic
967971047 3:194999709-194999731 CACCCACCAAGGGGCTGGGCTGG + Intergenic
968548278 4:1209720-1209742 CGCCCAGCAAGGCCCCAGGAGGG - Intergenic
968569124 4:1330081-1330103 AACCCACAAATGCCCCAGGCAGG - Intronic
968952458 4:3702055-3702077 AACCCACCAAGAACTCCGGCAGG - Intergenic
969526878 4:7708366-7708388 CACCCACCCGGGACCCCAGCTGG - Intronic
969527383 4:7710807-7710829 CACCCACCAAGGACAGGGGAAGG - Intronic
969588375 4:8107534-8107556 CAGCCACACAGGACCCGGGCAGG + Intronic
972805311 4:42523758-42523780 CACCTGCCAAGGACTGAGGCTGG + Intronic
977400047 4:96521168-96521190 CACCCACCCAGAATGCAGGCTGG - Intergenic
979609417 4:122673494-122673516 CATCCTCCAAGTACACAGGCTGG + Intergenic
979780926 4:124650789-124650811 CGCCCACCCAGAACCCATGCCGG - Intergenic
980992769 4:139752423-139752445 CACCCACCCTGGACCTAGCCTGG + Intronic
983199100 4:164841623-164841645 CTGCCACCAAGCACCCAGGATGG + Intergenic
983495570 4:168438725-168438747 CACCCAGCAAGCACCTAAGCTGG - Intronic
984266127 4:177499719-177499741 CGCCCACCCAGAACCCATGCTGG - Intergenic
985807445 5:2057430-2057452 CACCCACCAACGACCCCAGTGGG + Intergenic
985935785 5:3096740-3096762 CACCCACCAGGCACCAAGACAGG + Intergenic
986121107 5:4837585-4837607 CACCCACCCAGAACTCACGCTGG - Intergenic
986283269 5:6340766-6340788 TTCTCACCCAGGACCCAGGCTGG - Intergenic
988676827 5:33441171-33441193 CACCCACTAGAGTCCCAGGCTGG - Intronic
989209682 5:38846372-38846394 CACCCACCAGGTAGGCAGGCCGG - Exonic
992003740 5:72459002-72459024 CATCAACAAAGGACCCAGACTGG - Intronic
992124063 5:73623920-73623942 CAGCCAGCAAGAAACCAGGCTGG - Intergenic
992198442 5:74362205-74362227 CACCAACAAAGGATCCACGCCGG + Intergenic
992491710 5:77250733-77250755 AGGCCACCAATGACCCAGGCTGG - Intronic
996507157 5:124280388-124280410 CAAGCACCACAGACCCAGGCAGG + Intergenic
996679951 5:126220966-126220988 CACCTACCCAGAACCCACGCTGG - Intergenic
997461425 5:134055139-134055161 CAGCCACAAAGGAGACAGGCTGG + Intergenic
999202503 5:149826313-149826335 CCCCCACCAAGGACAGAGGCTGG - Intronic
999288087 5:150406203-150406225 TGCCCACCCAGGACCCTGGCCGG - Intronic
999580974 5:153037413-153037435 TACACCTCAAGGACCCAGGCTGG - Intergenic
1001494053 5:172175494-172175516 CACCCACCAGGGTGCCAGGAGGG + Intronic
1002598502 5:180339800-180339822 TCCCCACCAAGGGCACAGGCTGG + Intronic
1002632297 5:180590291-180590313 CTGCCACCAAGAACTCAGGCGGG + Intronic
1002940731 6:1713388-1713410 CACCCACCACCGGCCCACGCCGG + Intronic
1003047455 6:2746913-2746935 CACCCACCAACTAGGCAGGCAGG + Intronic
1005882971 6:30074522-30074544 CTCCTCCCAAGGCCCCAGGCAGG - Intronic
1006459453 6:34149927-34149949 CCCCCACCAAGGCACTAGGCAGG - Intronic
1007112601 6:39321682-39321704 AAACCAGAAAGGACCCAGGCAGG + Intronic
1007234508 6:40380586-40380608 TTCCCAGCAAGGACCCTGGCTGG + Intergenic
1007400519 6:41600015-41600037 CTCCCACCCCGGCCCCAGGCTGG + Exonic
1008587746 6:52964674-52964696 CCCCCACCAGGGACCCAAGCAGG + Intergenic
1009800703 6:68533480-68533502 CGCCCACCCAGAACTCAGGCTGG - Intergenic
1010269322 6:73903205-73903227 CACCCACCCAGAACTCACGCTGG - Intergenic
1017410048 6:154158274-154158296 AACCCACCAAGTACCCATGTTGG - Exonic
1019124204 6:169828333-169828355 CACCGCCCAAAGACACAGGCAGG - Intergenic
1019312002 7:367444-367466 CAGCCCCCAAGGCCCCAGGCAGG - Intergenic
1019547329 7:1584820-1584842 CACCCCCACAGTACCCAGGCTGG + Intergenic
1019867214 7:3722911-3722933 CAAACACCAAGGATTCAGGCTGG - Intronic
1022721130 7:32942749-32942771 CAAGCCCCCAGGACCCAGGCAGG - Intergenic
1023233427 7:38058225-38058247 CAGCCACCAAGAGCCTAGGCAGG + Intergenic
1023984108 7:45085396-45085418 CATCCACCATGGACCCCTGCGGG + Exonic
1024685876 7:51744651-51744673 CGACCACCAGGGACCAAGGCCGG + Intergenic
1025235521 7:57232230-57232252 GATCCCCCAAGGACCCTGGCTGG + Intergenic
1029188564 7:98756067-98756089 CTCCCACAGAGGACCCAGGTTGG + Intergenic
1029284470 7:99456314-99456336 CATCCACCAAGTCCCCAGTCGGG - Intronic
1033385688 7:140872831-140872853 ATCCCTCCAAGCACCCAGGCTGG - Intronic
1034129166 7:148699372-148699394 CACCCTCCGAGAACCCAGCCCGG - Intronic
1034369414 7:150581886-150581908 CAGCCAGAAAGGACCCATGCAGG - Intergenic
1034449672 7:151130555-151130577 CACCCACCCTAGCCCCAGGCAGG - Intronic
1034517796 7:151594177-151594199 CACCCAGCAAGGGCCCTGGAAGG - Intronic
1035649641 8:1255095-1255117 CACACACACAGCACCCAGGCAGG - Intergenic
1035649659 8:1255185-1255207 CACACACACAGCACCCAGGCAGG - Intergenic
1035649665 8:1255217-1255239 CACACACACAGCACCCAGGCAGG - Intergenic
1035649677 8:1255278-1255300 CACACACACAGCACCCAGGCAGG - Intergenic
1035649690 8:1255342-1255364 CACACACACAGCACCCAGGCAGG - Intergenic
1035649702 8:1255403-1255425 CACACACACAGCACCCAGGCAGG - Intergenic
1035649754 8:1255758-1255780 CACACACACAGCACCCAGGCAGG - Intergenic
1035649759 8:1255790-1255812 CACACACATAGCACCCAGGCAGG - Intergenic
1035649774 8:1255880-1255902 CACACACATAGCACCCAGGCAGG - Intergenic
1035649783 8:1255938-1255960 CACACACACAGCACCCAGGCAGG - Intergenic
1035649793 8:1255997-1256019 CACACACACAGCACCCAGGCAGG - Intergenic
1035649804 8:1256058-1256080 CACACACATAGCACCCAGGCAGG - Intergenic
1035649840 8:1256260-1256282 CACACACACAGCACCCAGGCAGG - Intergenic
1035649862 8:1256382-1256404 CACACACACAGCACCCAGGCAGG - Intergenic
1035649876 8:1256470-1256492 CACACACACAGCACCCAGGCAGG - Intergenic
1035649881 8:1256499-1256521 CACACACACAGCACCCAGGCAGG - Intergenic
1036384860 8:8270157-8270179 CACCCGCCAAGGACCCAACAGGG + Intergenic
1038350865 8:26775021-26775043 CACCCACCCCTGAACCAGGCTGG - Intronic
1039444902 8:37623180-37623202 GACCAACCTAGGTCCCAGGCTGG + Intergenic
1040027538 8:42795673-42795695 CACCCACCCAGAACTCACGCTGG - Intronic
1042812586 8:72842647-72842669 CACCCTCCCAGGACCAAGCCAGG - Intronic
1047493149 8:125390547-125390569 CACCTGCCAAGGCCACAGGCAGG - Intergenic
1048585877 8:135773341-135773363 CACCCCACAGGGACCCAGGCAGG - Intergenic
1049164922 8:141119671-141119693 CACTCACCCAGGGCCCAGGAGGG - Intronic
1049205947 8:141363672-141363694 CACCGGCCAAGGACGGAGGCCGG - Intronic
1049587075 8:143437176-143437198 CACCCACCCAGAGCCCAGGCAGG + Intergenic
1049587728 8:143439872-143439894 CCCTCACCAAGGACTCAGGTAGG - Intronic
1049587786 8:143440036-143440058 CCCTCACCAAGGACTCAGGTAGG - Exonic
1052507301 9:29371978-29372000 CACCCACCGAGAACTCAGGTTGG + Intergenic
1057140854 9:92726007-92726029 CACCTCCCAGGGGCCCAGGCAGG + Intronic
1057747273 9:97762260-97762282 TACCCACCCAGCAGCCAGGCGGG - Intergenic
1059327429 9:113512696-113512718 CCTGCACCCAGGACCCAGGCTGG + Intronic
1059782375 9:117543532-117543554 CCCCCACCTAGGATGCAGGCAGG + Intergenic
1061204411 9:129154762-129154784 CCCCCATCCAGGGCCCAGGCAGG - Intergenic
1061264811 9:129498631-129498653 CAGCAGCCAGGGACCCAGGCTGG + Intergenic
1062080158 9:134619520-134619542 CACACAACAAGGGCTCAGGCAGG - Intergenic
1062190488 9:135245477-135245499 CAACCACCAAGGACAGAGGGTGG + Intergenic
1062282006 9:135756373-135756395 CACCCACCCAGGAGCCAGCCAGG - Intronic
1062436676 9:136549423-136549445 CCCCCACCCAGGACCCAGCAGGG - Intergenic
1062723760 9:138059374-138059396 CTCCCTCCCAGGACCTAGGCTGG - Intronic
1190049702 X:47140582-47140604 CACCCTCCAAAGCCCCAGGCAGG + Intergenic
1190155868 X:47992069-47992091 CACACAACAAGCACCCAGCCAGG + Intronic
1190431993 X:50386963-50386985 CACACACCAAGCACCCAAGCAGG - Intronic
1192382876 X:70636165-70636187 CACAGACCCAGGCCCCAGGCAGG + Intronic
1196233662 X:113254708-113254730 CAACCACCAGGGACCAAGGGTGG - Intergenic
1196292943 X:113965344-113965366 AACCTAACAATGACCCAGGCTGG + Intergenic
1197796132 X:130300024-130300046 CACCCACCAAGAGCACAGGGAGG + Intergenic
1198107555 X:133475963-133475985 CACCCACCCAGGGCACTGGCAGG - Intergenic
1200908420 Y:8509374-8509396 CCCCCACAGAGGACACAGGCTGG - Intergenic