ID: 1176103278

View in Genome Browser
Species Human (GRCh38)
Location 20:63374193-63374215
Sequence AGACAAAGGCTGAACGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 155}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176103263_1176103278 18 Left 1176103263 20:63374152-63374174 CCCGGGACGTCCCGGGGAAGCCA 0: 1
1: 0
2: 1
3: 15
4: 131
Right 1176103278 20:63374193-63374215 AGACAAAGGCTGAACGGGCCGGG 0: 1
1: 0
2: 0
3: 17
4: 155
1176103268_1176103278 -2 Left 1176103268 20:63374172-63374194 CCACCCTCAGTGACTGGCCCCAG 0: 1
1: 1
2: 2
3: 54
4: 568
Right 1176103278 20:63374193-63374215 AGACAAAGGCTGAACGGGCCGGG 0: 1
1: 0
2: 0
3: 17
4: 155
1176103266_1176103278 7 Left 1176103266 20:63374163-63374185 CCGGGGAAGCCACCCTCAGTGAC 0: 1
1: 0
2: 0
3: 22
4: 219
Right 1176103278 20:63374193-63374215 AGACAAAGGCTGAACGGGCCGGG 0: 1
1: 0
2: 0
3: 17
4: 155
1176103269_1176103278 -5 Left 1176103269 20:63374175-63374197 CCCTCAGTGACTGGCCCCAGACA 0: 1
1: 0
2: 0
3: 25
4: 198
Right 1176103278 20:63374193-63374215 AGACAAAGGCTGAACGGGCCGGG 0: 1
1: 0
2: 0
3: 17
4: 155
1176103264_1176103278 17 Left 1176103264 20:63374153-63374175 CCGGGACGTCCCGGGGAAGCCAC 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1176103278 20:63374193-63374215 AGACAAAGGCTGAACGGGCCGGG 0: 1
1: 0
2: 0
3: 17
4: 155
1176103270_1176103278 -6 Left 1176103270 20:63374176-63374198 CCTCAGTGACTGGCCCCAGACAA 0: 1
1: 0
2: 5
3: 49
4: 482
Right 1176103278 20:63374193-63374215 AGACAAAGGCTGAACGGGCCGGG 0: 1
1: 0
2: 0
3: 17
4: 155
1176103259_1176103278 30 Left 1176103259 20:63374140-63374162 CCTTCAAGGGAGCCCGGGACGTC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1176103278 20:63374193-63374215 AGACAAAGGCTGAACGGGCCGGG 0: 1
1: 0
2: 0
3: 17
4: 155
1176103265_1176103278 8 Left 1176103265 20:63374162-63374184 CCCGGGGAAGCCACCCTCAGTGA 0: 1
1: 0
2: 1
3: 20
4: 197
Right 1176103278 20:63374193-63374215 AGACAAAGGCTGAACGGGCCGGG 0: 1
1: 0
2: 0
3: 17
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176103278 Original CRISPR AGACAAAGGCTGAACGGGCC GGG Intronic
901513156 1:9728098-9728120 AGACAATGGCAGAGTGGGCCGGG - Exonic
902345116 1:15810947-15810969 AGATAAAACCTGAACAGGCCGGG + Intergenic
902814303 1:18907498-18907520 TGAGAAAGTCTGAAGGGGCCAGG - Exonic
906551172 1:46667834-46667856 AGACAAACGTGGAACGAGCCAGG + Intronic
908241980 1:62195456-62195478 AGAAAAAGGATGGAGGGGCCGGG + Intronic
909901743 1:81146010-81146032 AGACAAAGGTTGGAAGGGGCAGG + Intergenic
910191507 1:84600703-84600725 AGAACAAGGCTGAAGGGGCAGGG + Intergenic
910526735 1:88187388-88187410 AGACAAAGTCAGATTGGGCCTGG - Intergenic
910935414 1:92482459-92482481 AGAACAGGGCAGAACGGGCCAGG - Intronic
910936482 1:92486903-92486925 AGTCGAAGGCTGAGCGGACCCGG - Intergenic
913988742 1:143588920-143588942 AGACAAAGGCTTCATGAGCCAGG + Intergenic
915274515 1:154778895-154778917 AGAAATAGGCTGTACTGGCCAGG - Intronic
916831472 1:168496395-168496417 AGAGAAAGACTGAACTGGCAAGG + Intergenic
917952445 1:180053895-180053917 AGACTAAGGCTGAATTGGCCTGG + Exonic
920760422 1:208778728-208778750 TGACAACCACTGAACGGGCCAGG + Intergenic
922275220 1:224071279-224071301 AAAAAAAGGCTGAGCTGGCCAGG - Intergenic
1063094871 10:2900380-2900402 TGACAGAGGCTGGAAGGGCCTGG - Intergenic
1064384269 10:14877252-14877274 AGACTAAGCCTTAAAGGGCCTGG + Intergenic
1067708543 10:48629103-48629125 AGGCAAAGGCTGAAAGGGCTGGG - Intronic
1068141614 10:53015458-53015480 AGACAAAAGCTAATGGGGCCGGG - Intergenic
1070422591 10:76251666-76251688 AGACAAAGGTTGAAGGGGACCGG + Intronic
1071015257 10:80989528-80989550 AGAGAAAGGCTGAAAGAGACTGG - Intergenic
1071589606 10:86860471-86860493 AGAAAAATGCTAAACGGGGCTGG + Intronic
1075229925 10:120667209-120667231 AGACAATGGCTGAGCAGGTCTGG + Intergenic
1075305016 10:121360075-121360097 AGAGATAGGAAGAACGGGCCAGG + Intergenic
1075880953 10:125850316-125850338 AGTCAAAGGCTGCAGAGGCCAGG - Intronic
1076163263 10:128262357-128262379 AGACAAAGGATGAAGGGGTGAGG - Intergenic
1081489080 11:43553481-43553503 GGACAACATCTGAACGGGCCAGG + Intergenic
1083342654 11:61968298-61968320 CAACAAAGGCTGGGCGGGCCGGG + Intergenic
1087129036 11:94653022-94653044 AGATGAAGACTGAAGGGGCCTGG + Intergenic
1091217759 11:133913736-133913758 AGACAAAGGGTGCAGGTGCCCGG + Intronic
1091962125 12:4705022-4705044 AGTAAAAAGCTGAACAGGCCAGG + Intronic
1096851845 12:54444738-54444760 AAAAAAAGAGTGAACGGGCCAGG + Intergenic
1099955194 12:89346410-89346432 AGACACTTGCTGAATGGGCCAGG + Intergenic
1100980285 12:100157772-100157794 ATACACAGGATGAACGGGGCAGG + Intergenic
1103059730 12:117848724-117848746 AGAAAAAGGCTGGAGGAGCCTGG + Intronic
1103583921 12:121936975-121936997 AGACCACGGCTGACCGGGCATGG - Intronic
1108217031 13:48195500-48195522 AGAAAAAGGCTGAAGAGGTCAGG + Intergenic
1110322349 13:74174532-74174554 AGACTAAGGCTGTACCAGCCAGG - Intergenic
1111653342 13:91121461-91121483 AGACAAAGGCTAGAAGGACCTGG - Intergenic
1117322164 14:54634451-54634473 AGACAAAGTTTCCACGGGCCAGG + Intronic
1117872317 14:60213942-60213964 AGAAAAAGGATCAAGGGGCCAGG - Intergenic
1118151155 14:63192288-63192310 TGACAAAGGCTGAGCAGGGCTGG + Intergenic
1119620959 14:76131544-76131566 AGACACCGGCTCCACGGGCCGGG + Intergenic
1120341533 14:83226353-83226375 AGACAAAGACCGAACGAGCTGGG - Intergenic
1125511182 15:40293243-40293265 AGCCCAAGGCTGAGGGGGCCTGG + Intronic
1127216542 15:56829280-56829302 AAAAATAGGCTGAAAGGGCCTGG + Intronic
1127647797 15:60975136-60975158 AGTCAAGGGCGGAAGGGGCCTGG + Intronic
1127772680 15:62243876-62243898 ATACACAGGATGAACGGGCCAGG + Intergenic
1130361136 15:83187591-83187613 AGAAAAAGGCTGCAGTGGCCGGG + Intronic
1135804968 16:25534398-25534420 AGAATAAGGATGAACTGGCCGGG + Intergenic
1137493264 16:48950656-48950678 AAATAAAGGCTGACCGAGCCTGG + Intergenic
1141348111 16:83267222-83267244 ACACAAAGGCTGAAGGTGCAGGG + Intronic
1142215860 16:88829519-88829541 AGACAAAGGCTGCCCTGGGCAGG + Intronic
1143068324 17:4267216-4267238 AGACAAGGGCTGGCCGGGCGTGG - Intergenic
1143739662 17:8942899-8942921 AGAATAAGGCTGACAGGGCCGGG - Intronic
1144769827 17:17753223-17753245 AGACACAGGCTGGAGGGGCCTGG + Intronic
1146159771 17:30553638-30553660 AGGTAAAGGCTGAAAGGGCCTGG - Intergenic
1147189530 17:38730505-38730527 AGACACCGGCGGGACGGGCCGGG - Intronic
1147724991 17:42561579-42561601 AGGCAAAGGCTGATTGGGCGCGG - Intronic
1148175073 17:45556932-45556954 AAAAAAAGGCTGAATGGGCCGGG + Intergenic
1148296299 17:46506095-46506117 AAAAAAAGGCTGAATGGGCCGGG - Intergenic
1148773526 17:50080167-50080189 AGACAAAGCCTGGAAGGGGCGGG + Intronic
1150406291 17:64903843-64903865 AAAAAAAGGCTGAATGGGCCGGG + Intronic
1150945745 17:69743623-69743645 TGACCAAGGCAGAAAGGGCCTGG + Intergenic
1151087471 17:71397534-71397556 ATATAAAGACTGAACAGGCCAGG + Intergenic
1152046489 17:77939755-77939777 AGAAAAAGACTGGAAGGGCCGGG - Intergenic
1152706299 17:81845306-81845328 AGAGAAAGGCAGAGCAGGCCCGG + Intronic
1153225601 18:2897450-2897472 AGACACAGGGTGAAGGGCCCTGG + Intronic
1153672915 18:7429609-7429631 AGACCGTGGCTGAACAGGCCAGG + Intergenic
1154336775 18:13472105-13472127 AGACCGAGGGTGGACGGGCCTGG + Intronic
1156471525 18:37380041-37380063 AGCCACAAGCTGAAAGGGCCTGG - Intronic
1157770069 18:50338050-50338072 AGCCAAAGGGTGAACAGGGCTGG - Intergenic
1160234196 18:77072908-77072930 TGACAATGGCTGAACAGGCCAGG - Intronic
1160761882 19:789593-789615 AGAGAAAGGCAGGAAGGGCCCGG - Intergenic
1162822330 19:13230512-13230534 AGACAAAGACTGGCCGGGCACGG + Intronic
1163793896 19:19324510-19324532 AGAAACAGGCTGAACAGCCCTGG - Intronic
1163862088 19:19747909-19747931 AGGCCAGGGCAGAACGGGCCAGG + Intergenic
1164271011 19:23671619-23671641 AGATGAAGACTGAAGGGGCCTGG + Intronic
1167368729 19:49068193-49068215 AGAAAAAGGCAGAAAAGGCCGGG - Exonic
1168074933 19:53975672-53975694 AGAGAATGGTTGAATGGGCCAGG - Intronic
925357713 2:3253849-3253871 AGGCAAAAGCTGAAATGGCCAGG + Intronic
926127151 2:10278667-10278689 AGACACAGGCGGAAGTGGCCAGG - Intergenic
928543100 2:32301998-32302020 AGAAAAATGCTGACCAGGCCGGG - Intronic
931434036 2:62231791-62231813 AGACTGAGGCTGGAAGGGCCTGG - Intergenic
935622832 2:105144120-105144142 AGACAAAGGCTGCGCGGCCGCGG - Intergenic
935853473 2:107248799-107248821 AGACCACAGCTGAAAGGGCCTGG + Intergenic
936465247 2:112742558-112742580 TGACAATGGCTGAAAGGGCCAGG + Exonic
936819066 2:116496848-116496870 AGAGAAAGGCTCAAGGGTCCAGG + Intergenic
937357438 2:121206904-121206926 AGAAAATGGCAGAACGGGCCAGG + Intergenic
939114469 2:138044626-138044648 AGACAATGGCTGGAAGGGACAGG + Intergenic
940376974 2:152968310-152968332 AGATGAAGACTGAAGGGGCCTGG - Intergenic
940515786 2:154682515-154682537 AGAAAAAGTCTGAACAAGCCGGG - Intergenic
1173526656 20:43738131-43738153 AGATAAAGACTGAGCTGGCCTGG + Intergenic
1173663823 20:44751785-44751807 ACACAAAGCATGAACGAGCCAGG + Exonic
1174562457 20:51440985-51441007 AAACAAATGCTGATGGGGCCAGG + Intronic
1174713110 20:52728187-52728209 AGGCACAGGCTCAGCGGGCCGGG - Intergenic
1175133135 20:56804375-56804397 AGAAGAAGGCTGAACTGGCCGGG - Intergenic
1175925867 20:62471067-62471089 AGACAAAGGCTCAAAGAGCTGGG + Intronic
1176103278 20:63374193-63374215 AGACAAAGGCTGAACGGGCCGGG + Intronic
1177405024 21:20655854-20655876 ATACAAACACTGAACAGGCCAGG - Intergenic
1180992997 22:19949366-19949388 GGACAAAGCCTGAATGGCCCAGG - Intronic
1181667435 22:24407818-24407840 AGACAAATGAAGAATGGGCCAGG - Intronic
1182697860 22:32208497-32208519 AGACCAGGGCTCACCGGGCCTGG - Intergenic
1182934838 22:34211028-34211050 ATATAAAGGCAGAACAGGCCAGG + Intergenic
1185343180 22:50300501-50300523 AGGCAAAGGCCGAACGCTCCCGG + Intronic
949942994 3:9169075-9169097 ACACAATAGCTGAACGAGCCGGG - Intronic
950355995 3:12409837-12409859 AGGCAAATGCTGAGCGGGCAGGG - Intronic
952171157 3:30808198-30808220 AAGCAAAGGATGAACCGGCCGGG + Intronic
953561500 3:43996462-43996484 AGGCAAAGGCTGGTGGGGCCAGG + Intergenic
953566007 3:44032655-44032677 TGACAAAGGCTGAACAGGCAAGG - Intergenic
955446647 3:59018105-59018127 ACACATAGGCTGCACTGGCCAGG + Intronic
956192768 3:66622932-66622954 AGACGAAGGCTGACTGGGCCTGG - Intergenic
960965496 3:123101515-123101537 AGACAAAAGGAGAAAGGGCCAGG - Intronic
961137889 3:124528754-124528776 AGATAATGGCTGAATGGGGCAGG + Intronic
964457919 3:156888532-156888554 ATAAAAAGACTGAAAGGGCCTGG + Intronic
964776752 3:160287519-160287541 AGAGAAAGGATGAAAGGGCAGGG + Intronic
966192910 3:177287599-177287621 AGAGAAAGGCTGGAGGAGCCGGG + Intergenic
971377902 4:26069796-26069818 ACAGAAAGGCAGAAAGGGCCTGG - Intergenic
974497023 4:62644520-62644542 AGACAGAGGCAGAAAGGGACAGG + Intergenic
977750017 4:100598586-100598608 AGAGAAAGGATGAAGAGGCCTGG + Intronic
983600720 4:169524211-169524233 AGAAAAATGTTGAATGGGCCGGG + Intronic
984653269 4:182291354-182291376 AGACAAAGCATGAAAGAGCCTGG + Intronic
992859741 5:80898244-80898266 AGATGAAGACTGAAGGGGCCTGG - Intergenic
995614778 5:113949642-113949664 AGACAAAGAAAGAACGGGTCTGG - Intergenic
998388734 5:141773457-141773479 AGACATAGGCTGCAGGGTCCGGG - Intergenic
999170659 5:149591371-149591393 AGACAAAGGCTGGCCGAGCACGG - Intronic
999398701 5:151248130-151248152 AGATGAAGACTGAAGGGGCCCGG - Intronic
1003331541 6:5133452-5133474 TGACAGAGGCTGGACGGGTCAGG - Intronic
1003936398 6:10979042-10979064 ATAAAAAGGATGAATGGGCCGGG + Intronic
1005955789 6:30662566-30662588 AGACAATGGCTGAATTGGCTGGG + Intronic
1005964865 6:30720229-30720251 AGACAAAGCCTCATCGAGCCTGG - Exonic
1006811237 6:36821814-36821836 AGACAAGGTCTTAACGGGCACGG + Intronic
1007068075 6:39013554-39013576 AGAAAAAGGCACAAAGGGCCAGG + Intronic
1008052919 6:46918283-46918305 AGATAAATACTGAACAGGCCCGG + Intronic
1010884327 6:81217951-81217973 AGACAATGGCTTCATGGGCCAGG + Intergenic
1011058085 6:83228572-83228594 AGAAAAGTGCTGAACGTGCCAGG + Intronic
1018955710 6:168409243-168409265 AAAAAAAGGCTGAAAGGGCTGGG + Intergenic
1019965383 7:4494529-4494551 AGAAACAGGCACAACGGGCCGGG + Intergenic
1020109106 7:5438149-5438171 AGACACAGGGTGAAGAGGCCAGG + Intronic
1021693718 7:23255305-23255327 AGACAAATGCTGACTGGGCGCGG - Intronic
1022370487 7:29766470-29766492 TGACAAAGGCTGAATGTGCAGGG - Intergenic
1026954174 7:74366332-74366354 GGACAAGGGGTGAACGGACCTGG - Intronic
1027178877 7:75923595-75923617 AGACAGTGGCTGGCCGGGCCCGG + Intronic
1028752204 7:94394320-94394342 AGAGAAAAGCTGGACGGGGCTGG + Intergenic
1031802465 7:126265242-126265264 AGACAATGGCTGAATGGGGCTGG - Intergenic
1035185728 7:157124724-157124746 ATACAAACGCTGAATGAGCCCGG - Intergenic
1038708630 8:29920589-29920611 AGATAAATGCTGAATAGGCCTGG + Intergenic
1039475792 8:37838860-37838882 GGACCAAGGCTGACGGGGCCTGG + Intronic
1040870260 8:52093459-52093481 AGACAAAGGCTGGTGGGGCCAGG - Intergenic
1040914431 8:52554874-52554896 AGATAAAGGCCGACAGGGCCGGG + Intronic
1042304598 8:67317940-67317962 AGAAATAGGCTAAACAGGCCAGG + Intronic
1046632254 8:116632727-116632749 AAACAAGGGCTCTACGGGCCGGG + Intergenic
1047652085 8:126933576-126933598 AGAAAAAGGCCCAATGGGCCGGG - Intergenic
1048389830 8:133952199-133952221 CTGCAAAGGCTGAACTGGCCAGG + Intergenic
1049047147 8:140161816-140161838 AGAGAAAGGCAGAAAGGGCAAGG + Intronic
1049584188 8:143425418-143425440 AGGGAGAGGCTGAAGGGGCCGGG - Intronic
1053415558 9:37944936-37944958 AGACACAGGCTGGCCTGGCCAGG + Intronic
1056406633 9:86282011-86282033 AAGCAGAGGCTGAACGTGCCCGG - Intronic
1060941111 9:127543349-127543371 AGACAGAGGCTGGAAGGTCCAGG + Intronic
1061892243 9:133629059-133629081 AGACAAAGGCAGAAAGAGGCAGG - Intergenic
1062449313 9:136608938-136608960 GGACAAATGCCAAACGGGCCGGG + Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1186684644 X:11912832-11912854 AGAAAAATGGTGAAGGGGCCGGG + Intergenic
1187155418 X:16716642-16716664 AGAGTAAGGCTGAAAGGGCTGGG + Intergenic
1189516657 X:41719236-41719258 AGACAAAGGATGAAAGGGTTGGG + Intronic
1194074155 X:89367900-89367922 AGACAAAGCCTCAGCAGGCCTGG + Intergenic
1194093243 X:89603588-89603610 AGAAAATGGCTTAACTGGCCAGG + Intergenic
1197794215 X:130283071-130283093 AGATGAAGACTGAAGGGGCCTGG + Intergenic
1198083211 X:133259286-133259308 ACACAAAGCATGCACGGGCCAGG + Intergenic
1200445875 Y:3259691-3259713 AGAAAATGGCTTAACTGGCCAGG + Intergenic
1200729547 Y:6719427-6719449 AGACAAAGCCTCAGCAGGCCTGG + Intergenic
1200788456 Y:7279031-7279053 AGTAAAAGGCTGAACAAGCCAGG - Intergenic