ID: 1176103910

View in Genome Browser
Species Human (GRCh38)
Location 20:63376855-63376877
Sequence GCTCTGAGGACACCTCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 439}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176103906_1176103910 10 Left 1176103906 20:63376822-63376844 CCAGGGTCACGGTCTACAGGCTG 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1176103910 20:63376855-63376877 GCTCTGAGGACACCTCAACCTGG 0: 1
1: 0
2: 1
3: 36
4: 439
1176103905_1176103910 11 Left 1176103905 20:63376821-63376843 CCCAGGGTCACGGTCTACAGGCT 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1176103910 20:63376855-63376877 GCTCTGAGGACACCTCAACCTGG 0: 1
1: 0
2: 1
3: 36
4: 439
1176103895_1176103910 28 Left 1176103895 20:63376804-63376826 CCCCTCTCCGTGCAGCCCCCAGG 0: 1
1: 0
2: 4
3: 37
4: 447
Right 1176103910 20:63376855-63376877 GCTCTGAGGACACCTCAACCTGG 0: 1
1: 0
2: 1
3: 36
4: 439
1176103904_1176103910 12 Left 1176103904 20:63376820-63376842 CCCCAGGGTCACGGTCTACAGGC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1176103910 20:63376855-63376877 GCTCTGAGGACACCTCAACCTGG 0: 1
1: 0
2: 1
3: 36
4: 439
1176103900_1176103910 21 Left 1176103900 20:63376811-63376833 CCGTGCAGCCCCCAGGGTCACGG 0: 1
1: 0
2: 1
3: 21
4: 274
Right 1176103910 20:63376855-63376877 GCTCTGAGGACACCTCAACCTGG 0: 1
1: 0
2: 1
3: 36
4: 439
1176103899_1176103910 26 Left 1176103899 20:63376806-63376828 CCTCTCCGTGCAGCCCCCAGGGT 0: 1
1: 0
2: 4
3: 21
4: 302
Right 1176103910 20:63376855-63376877 GCTCTGAGGACACCTCAACCTGG 0: 1
1: 0
2: 1
3: 36
4: 439
1176103897_1176103910 27 Left 1176103897 20:63376805-63376827 CCCTCTCCGTGCAGCCCCCAGGG 0: 1
1: 0
2: 3
3: 36
4: 340
Right 1176103910 20:63376855-63376877 GCTCTGAGGACACCTCAACCTGG 0: 1
1: 0
2: 1
3: 36
4: 439
1176103902_1176103910 13 Left 1176103902 20:63376819-63376841 CCCCCAGGGTCACGGTCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 98
Right 1176103910 20:63376855-63376877 GCTCTGAGGACACCTCAACCTGG 0: 1
1: 0
2: 1
3: 36
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176103910 Original CRISPR GCTCTGAGGACACCTCAACC TGG Intronic
901124768 1:6921338-6921360 CATCTGAGACCACCTCAACCTGG + Intronic
901197428 1:7447945-7447967 GCTCTGAGGTCAGACCAACCTGG - Intronic
902472134 1:16656617-16656639 GCTCTGAGAACAGCTGGACCAGG - Intergenic
902486669 1:16750829-16750851 GCTCTGAGAACAGCTGGACCAGG + Intronic
902965468 1:19997951-19997973 GCTCTGGTGACCCTTCAACCTGG - Intergenic
903854732 1:26330324-26330346 GCTCTGACGACAAATAAACCTGG - Intronic
905297561 1:36963792-36963814 CCTCTGAGGTCACACCAACCTGG - Intronic
905382389 1:37572164-37572186 GCTGTGAGGAAAACTAAACCAGG - Intronic
906894606 1:49757590-49757612 CATCTGAGACCACCTCAACCTGG - Intronic
907372795 1:54013990-54014012 GCTCTGATGTCACCTCCTCCAGG - Intronic
908618850 1:65952982-65953004 GCTCTCAGGCCACCTCCACCGGG + Intronic
909197826 1:72649185-72649207 GCTCTCAGGAGACCTAAAGCTGG - Intergenic
909261231 1:73491633-73491655 GCTCTGAGAACTCCTCAAGTGGG - Intergenic
910233309 1:85008688-85008710 CCTCTGAGATCACCTCAGCCTGG + Intronic
910628806 1:89336501-89336523 CCTCTGAGACCACCTCAGCCTGG - Intergenic
910817779 1:91311111-91311133 CATCTGAGACCACCTCAACCTGG - Intronic
911011712 1:93287948-93287970 CATCTGAGGCCACCTCAGCCTGG - Intergenic
911082898 1:93950802-93950824 TCTCTGAGACCACCTCAGCCTGG + Intergenic
912068575 1:105779043-105779065 CATCTGAGGCCACCTCAGCCTGG - Intergenic
912625773 1:111203943-111203965 TCTGGGAGGACACCACAACCGGG + Intronic
912933746 1:113985366-113985388 GCCCTGTGGACCCCTCAGCCTGG + Intergenic
913081935 1:115396141-115396163 CATCTGAGACCACCTCAACCTGG + Intergenic
915001896 1:152601405-152601427 TCTCTGGGGTCACCTCTACCAGG - Intergenic
916734894 1:167598841-167598863 CATCTGAGGCCACCTCAGCCTGG + Intergenic
917731954 1:177883290-177883312 TCTCTGAGGTCACCTCTTCCTGG - Intergenic
919212777 1:194509946-194509968 CATCTGAGAACACCTCAACCTGG - Intergenic
920047681 1:203144169-203144191 GCTCAGATGACACCTCCCCCAGG + Intronic
920555975 1:206904919-206904941 GCTCTGAGAACACATGAAGCAGG + Exonic
921763104 1:218939978-218940000 CATCTGAGACCACCTCAACCTGG - Intergenic
923942169 1:238840494-238840516 GCTCTGAGGCAATCTCAACCAGG - Intergenic
924394660 1:243606374-243606396 CATCTGAGGCCACCTCAGCCTGG - Intronic
1062922791 10:1292759-1292781 GGCCTGAGGACACCCCAACGGGG + Intronic
1063626310 10:7693003-7693025 CATCTGAGACCACCTCAACCTGG + Intergenic
1065572234 10:27082802-27082824 GCTCTGAAGACTCCTTAAGCAGG - Exonic
1066669158 10:37818491-37818513 GATCTGATGAAACCTGAACCAGG - Intronic
1068155049 10:53187525-53187547 CATCTGAGGCCACCTCAGCCTGG - Intergenic
1068355912 10:55907964-55907986 CATCTGAGACCACCTCAACCTGG + Intergenic
1069173702 10:65263405-65263427 CATCTGAGACCACCTCAACCTGG + Intergenic
1069579044 10:69552622-69552644 GCTCTGCTGACACCTCACCCAGG + Intergenic
1070633419 10:78104969-78104991 TATCTGAGACCACCTCAACCTGG - Intergenic
1071255396 10:83867752-83867774 GCTCTCAGAAAAGCTCAACCTGG + Intergenic
1073428695 10:103472017-103472039 GCTCTGAGGAAATCTTCACCAGG + Intergenic
1073942310 10:108712931-108712953 CATCTGAGACCACCTCAACCTGG - Intergenic
1074152697 10:110771692-110771714 GCTCACAGGACACCTCCTCCAGG - Intronic
1075712118 10:124536395-124536417 GCTCCGAGGCCACCCCAGCCAGG + Intronic
1076449697 10:130548440-130548462 CCTCAGAGGCCACCACAACCTGG - Intergenic
1076561912 10:131372451-131372473 GTTCTGTGGTCACCTAAACCTGG + Intergenic
1077555771 11:3225413-3225435 GCTCAAAGGCCACCTCCACCTGG - Intergenic
1078026967 11:7705195-7705217 GCTTGGAGATCACCTCAACCAGG + Intronic
1078453085 11:11454744-11454766 GCTTTGAGGACACCGCAGGCTGG - Intronic
1078687340 11:13545841-13545863 CATCTGAGAACACCTCAACCTGG - Intergenic
1078989788 11:16635320-16635342 CATCTGAGGCCACCTCAGCCTGG - Intronic
1079511418 11:21215605-21215627 CATCTGAGACCACCTCAACCTGG - Intronic
1080991878 11:37546290-37546312 TGTCTGAGACCACCTCAACCTGG + Intergenic
1081045701 11:38270482-38270504 CATCTGAGGCCACCTCAGCCTGG + Intergenic
1081316641 11:41638249-41638271 CATCTGAGGCCACCTCACCCTGG + Intergenic
1082268196 11:50142328-50142350 CATCTGAGGTCACCTCAGCCTGG - Intergenic
1083084973 11:60133614-60133636 CATCTGAGACCACCTCAACCTGG - Intergenic
1084533164 11:69741249-69741271 GCTCTGAGGCCATCAGAACCTGG + Intergenic
1084669429 11:70596436-70596458 GCTCTGAGGACCCCCTACCCGGG + Intronic
1084671864 11:70611713-70611735 TCTCAGACGACACCTCCACCAGG - Intronic
1086519320 11:87651662-87651684 CATCTGAGAACACCTCAGCCTGG + Intergenic
1087385434 11:97463431-97463453 CTTCTGAGACCACCTCAACCTGG - Intergenic
1087838062 11:102894600-102894622 CGTCTGAGACCACCTCAACCTGG + Intergenic
1088484838 11:110330502-110330524 GCTCTGAGACCTCCTCAGCCTGG + Intergenic
1090080210 11:123607480-123607502 GATCTGTGGACACCTCTCCCAGG + Intronic
1091913243 12:4249087-4249109 GCCCTGTGGCCACCTCAAGCTGG - Intergenic
1092167187 12:6349364-6349386 GGTCTGAGGAGAAGTCAACCTGG + Exonic
1092618261 12:10235149-10235171 CATCTGAGGCCACCTCAGCCTGG + Intergenic
1092665528 12:10792319-10792341 CATCTGAGACCACCTCAACCCGG + Intergenic
1093435701 12:19131178-19131200 GCTCTGAGGACTGCTGAAACTGG - Intronic
1093590526 12:20896539-20896561 CATCTGAGACCACCTCAACCTGG + Intronic
1094511738 12:31101371-31101393 CCTCTGAGGACGCCTCACACAGG + Intronic
1094738180 12:33259134-33259156 CATCTGAGGCCACCTCAGCCTGG - Intergenic
1094762500 12:33550768-33550790 CATCTGAGACCACCTCAACCTGG - Intergenic
1095234726 12:39782797-39782819 CCTCTGAGACCACCTCAGCCTGG - Intronic
1097329697 12:58319318-58319340 TCTCTGAGACCACCTCAGCCTGG + Intergenic
1097410936 12:59252428-59252450 TATCTGAGAACACCTCAGCCTGG - Intergenic
1097486660 12:60212140-60212162 CATCTGAGACCACCTCAACCTGG - Intergenic
1097998962 12:65921031-65921053 CATCTGAGAACACCTCAACCTGG - Intronic
1099507670 12:83499632-83499654 CATCTGAGAACACCTCAGCCTGG - Intergenic
1099954065 12:89335648-89335670 GCTCTGAGGTCAGCCCAGCCCGG + Intergenic
1100054247 12:90490111-90490133 TATCTGAGAACACCTCAGCCTGG - Intergenic
1101449365 12:104762354-104762376 GTTCTGAAGGCACATCAACCTGG - Intergenic
1103345054 12:120243818-120243840 CCTATGAGAACACCTCAAGCTGG + Intronic
1106590309 13:31092882-31092904 GCACAGGGGACACCTCACCCTGG + Intergenic
1106718691 13:32417767-32417789 TCTCTGAGACCACCTCAGCCTGG - Intronic
1106734703 13:32577437-32577459 CATCTGAGACCACCTCAACCTGG - Intergenic
1106929747 13:34651504-34651526 CATCTGAGACCACCTCAACCTGG - Intergenic
1106942707 13:34795404-34795426 CGTCTGAGACCACCTCAACCTGG - Intergenic
1107330623 13:39296002-39296024 CATCTGAGACCACCTCAACCTGG - Intergenic
1107528303 13:41256275-41256297 GTTCTGATGACACCTTAGCCAGG - Intronic
1107636595 13:42398417-42398439 TCCCTGAGGACACCTCCAACAGG - Intergenic
1108981881 13:56524272-56524294 TATCTGAGAACACCTCAGCCTGG + Intergenic
1109224218 13:59673109-59673131 GCTCTGTGCACACAACAACCAGG + Intronic
1109337086 13:61007437-61007459 CATCTGAGGCCACCTCAGCCTGG - Intergenic
1109667670 13:65559818-65559840 TCTCTGAGACCACCTCAACCTGG + Intergenic
1110793725 13:79613293-79613315 CATCTGAGACCACCTCAACCTGG + Intergenic
1110806218 13:79757241-79757263 CATCTGAGGCCACCTCATCCTGG + Intergenic
1111010100 13:82301330-82301352 TATCTGAGACCACCTCAACCTGG - Intergenic
1111212551 13:85098365-85098387 CATTTGAGAACACCTCAACCTGG - Intergenic
1111221246 13:85207872-85207894 CCTCTGAGACCACCTCAGCCTGG - Intergenic
1111325904 13:86695558-86695580 CATCTGAGACCACCTCAACCTGG + Intergenic
1111385384 13:87520822-87520844 CATCTGAGAACACCTCAGCCTGG - Intergenic
1112448483 13:99488759-99488781 GCTCTGAGGTAACCCAAACCCGG + Intergenic
1112861459 13:103833095-103833117 CCTCTGAGACCACCTCAACCTGG - Intergenic
1113496898 13:110738101-110738123 CATCTGAGACCACCTCAACCTGG - Intergenic
1114733435 14:25018624-25018646 GCTCTGTGGATTCCTGAACCAGG - Intronic
1114798225 14:25740674-25740696 CATCTGAGACCACCTCAACCTGG + Intergenic
1116378478 14:44233087-44233109 CATCTGAGACCACCTCAACCTGG + Intergenic
1117193016 14:53312324-53312346 CATCTGAGACCACCTCAACCTGG + Intergenic
1118166382 14:63340517-63340539 GCTCAGAGGACATTTCATCCCGG - Intergenic
1119142879 14:72283917-72283939 CATCTGAGAACACCTCAATCTGG - Intronic
1119862558 14:77947141-77947163 CATCTGAGGCCACCTCAGCCTGG - Intergenic
1119880785 14:78097854-78097876 CATCTGAGGCCACCTCAGCCTGG + Intergenic
1120287700 14:82525265-82525287 ACTTTGAGGATGCCTCAACCTGG - Intergenic
1120418013 14:84244160-84244182 TATCTGAGAACACCTCAGCCTGG + Intergenic
1120620209 14:86753619-86753641 CATCTGAGAACACCTCAGCCTGG + Intergenic
1121563865 14:94894244-94894266 GCCATGAGGAAACCTCAGCCTGG - Intergenic
1122382221 14:101316381-101316403 CCTCTGAGGCCACCACAACGTGG - Intergenic
1122828908 14:104386022-104386044 GCTCTGAGGACGGCTGAACAAGG + Intergenic
1123147708 14:106150100-106150122 CATCTGAGGCCACCTCAGCCTGG - Intergenic
1124361739 15:29042018-29042040 GTCCTGAGGACACCTCAATCTGG - Intronic
1125887349 15:43238665-43238687 GCTGTGAGGCCACCCCAACTGGG + Intronic
1126274648 15:46862640-46862662 CATCTGAGATCACCTCAACCTGG - Intergenic
1128688929 15:69708423-69708445 CATCTGAGGCCACCTCAGCCTGG + Intergenic
1129604133 15:77016558-77016580 GCTCTGTGGACAGCTGAGCCTGG + Intronic
1130569057 15:85024122-85024144 GCTCTGAGATCACCTCTTCCGGG + Intronic
1132336420 15:101051157-101051179 GCCCTGAGGGCACCTCCACAGGG + Intronic
1132826407 16:1907671-1907693 GCTCTGAGGACCCCCCAGTCAGG + Intergenic
1136275603 16:29177699-29177721 GCTCAGAGGACACATCCAGCCGG - Intergenic
1136691039 16:32029339-32029361 CATCTGAGGCCACCTCAGCCTGG + Intergenic
1136791628 16:32972899-32972921 CATCTGAGGCCACCTCAGCCTGG + Intergenic
1136878188 16:33881031-33881053 CATCTGAGGCCACCTCAGCCTGG - Intergenic
1136929486 16:34406451-34406473 GCCCTGCGGACACCTTGACCTGG + Intergenic
1136975088 16:35005353-35005375 GCCCTGCGGACACCTTGACCTGG - Intergenic
1137686415 16:50390135-50390157 GCTCTGACGCCACCTCCTCCAGG + Intergenic
1138046830 16:53733471-53733493 GCTCTGAGGAGATATCAACACGG + Intronic
1138533875 16:57649487-57649509 GCTCAGAGGACACCTCCTCCAGG - Intronic
1138824920 16:60307584-60307606 GCTCTCAGTACACATAAACCTGG - Intergenic
1141142753 16:81507756-81507778 GATCTGCGGCCACCCCAACCAGG - Intronic
1141214122 16:82008488-82008510 TCTCTGAGACCACCTCAGCCTGG - Intronic
1141672652 16:85500794-85500816 GCTCTGCAGACACCTCGATCTGG - Intergenic
1203093837 16_KI270728v1_random:1234360-1234382 CATCTGAGGCCACCTCAGCCTGG + Intergenic
1143279406 17:5741030-5741052 GCTTTGAGGACCCCTGGACCAGG - Intergenic
1144780162 17:17804057-17804079 GCTCTGGGCACTCCTCAAGCAGG - Intronic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1148968431 17:51457824-51457846 CCTGTGAGGACACCTCAAGAAGG - Intergenic
1149112444 17:53049357-53049379 CATCTGAGGCCACCTCAGCCTGG + Intergenic
1149216287 17:54358151-54358173 CATCTGAGGCCACCTCAGCCTGG + Intergenic
1151024380 17:70660103-70660125 GCTCTGAGAAAATCTCAGCCAGG + Intergenic
1152360794 17:79832229-79832251 CCTGTGCGGCCACCTCAACCAGG + Intergenic
1152459237 17:80432606-80432628 GCTCTGGGGACCCCTCATGCTGG + Intronic
1152570115 17:81117989-81118011 GCTCACAGGACACTTAAACCAGG - Exonic
1152608110 17:81303086-81303108 GCTCTGAGCACACCCCTGCCCGG - Intergenic
1152707764 17:81853856-81853878 GCTCTAGGGACAGCTGAACCTGG - Intronic
1153262797 18:3240838-3240860 CATCTGAGACCACCTCAACCTGG - Intergenic
1155153303 18:23138653-23138675 GCTCTCAGCACACTTCAACTAGG - Intronic
1155171443 18:23269708-23269730 CATCTGAGACCACCTCAACCTGG - Intronic
1155679580 18:28473507-28473529 CCTCTGAGACCACCTCAGCCTGG - Intergenic
1156151683 18:34250667-34250689 TCTCTGAGACCACCTCAGCCTGG + Intergenic
1156376879 18:36522717-36522739 GCTCTGGGGACTCCTCTCCCAGG - Intronic
1156583697 18:38408956-38408978 CATCTGAGGCCACCTCAGCCTGG - Intergenic
1156769951 18:40708248-40708270 ACTCTGAGCAAACCTCAACTAGG - Intergenic
1156904556 18:42337604-42337626 CATCTGAGGCCACCTCAGCCTGG + Intergenic
1156914456 18:42448626-42448648 CATCTGAGAACACCTCAGCCTGG + Intergenic
1157297689 18:46457900-46457922 GCTCTGAGGTCACATCAGCTAGG + Exonic
1157820629 18:50765767-50765789 CATCTGAGACCACCTCAACCTGG + Intergenic
1158070994 18:53470319-53470341 CATCTGAGGACACCTCAGCCTGG + Intronic
1158222918 18:55168756-55168778 CATCTGAGACCACCTCAACCTGG - Intergenic
1161649382 19:5474917-5474939 ACTCTGTGGACACCTGAATCAGG - Intergenic
1162283254 19:9717404-9717426 GCTCTGGTGACACTTCAACCTGG + Intergenic
1163371569 19:16904018-16904040 CCTCTGGGGACACACCAACCTGG - Intronic
1163713086 19:18858544-18858566 GCCCTGAGGCCACATCAAGCTGG - Intronic
1164274524 19:23704931-23704953 CATCTGAGGCCACCTCAGCCTGG - Intergenic
1166541257 19:43607610-43607632 GCTCTGCCTACACCTCACCCCGG + Exonic
1167329756 19:48847905-48847927 TCTCTGAGGACTCCTCGCCCTGG + Exonic
1202704531 1_KI270713v1_random:13411-13433 GCTCTGAGAACAGCTGGACCAGG - Intergenic
925085241 2:1102515-1102537 GCTAAAAGGAAACCTCAACCTGG - Intronic
925245516 2:2379174-2379196 CCTCTGAGACCACCTCAGCCTGG - Intergenic
925275784 2:2647270-2647292 GCTCTGAGGACACCTGCCCTGGG + Intergenic
928242892 2:29601933-29601955 CCTCTGAGGACACCTGAAGGTGG + Intronic
928587269 2:32773255-32773277 GCTCTGCAGAAATCTCAACCAGG + Intronic
928749280 2:34453238-34453260 CATCTGAGACCACCTCAACCTGG + Intergenic
930006697 2:46903555-46903577 CATCTGAGGCCACCTCAGCCTGG - Exonic
930183158 2:48385047-48385069 GCTCTGGCGACCCTTCAACCTGG - Intergenic
930280528 2:49363329-49363351 CATCTGAGGCCACCTCAGCCTGG + Intergenic
932429929 2:71668050-71668072 GCTCTGAGCTCACCTCTTCCAGG - Intronic
932585573 2:73025966-73025988 GCTCTGAGGACACCACAGGCAGG + Intronic
933790667 2:85881510-85881532 CATCTGAGACCACCTCAACCTGG - Intronic
934225175 2:90125875-90125897 CATCTGAGAACACCTCAGCCTGG + Intergenic
936493747 2:112999217-112999239 GCTCTGAGAAAGTCTCAACCTGG + Intergenic
937907253 2:127058404-127058426 GCTATGAGAACACCCCCACCTGG + Intronic
938968646 2:136410654-136410676 GCTCTGAGGAAACCCCAGCTTGG + Intergenic
939279130 2:140039457-140039479 CATCTGAGATCACCTCAACCTGG + Intergenic
939605763 2:144253526-144253548 CATCTGAGACCACCTCAACCTGG - Intronic
939667027 2:144964967-144964989 CATCTGAGGCCACCTCAGCCTGG - Intergenic
939781897 2:146459494-146459516 CATCTGAGAACACCTCAGCCTGG + Intergenic
940311030 2:152279200-152279222 GCTCTGGTGACCCTTCAACCTGG + Intergenic
940378582 2:152987018-152987040 GCTCTGGGGAAAGCTCAACAAGG + Intergenic
940444671 2:153764061-153764083 CATCTGAGAACACCTCAGCCTGG - Intergenic
940484012 2:154274940-154274962 TCTCTGAGACCACCTCAGCCTGG - Intronic
940815060 2:158288568-158288590 CATCTGAGGCCACCTCACCCTGG + Intronic
941335766 2:164241470-164241492 CATCTGAGAACACCTCAGCCTGG + Intergenic
942054189 2:172167397-172167419 CATCTGAGAACACCTCATCCTGG - Intergenic
943092849 2:183395096-183395118 CATCTGAGAACATCTCAACCTGG - Intergenic
943386620 2:187209966-187209988 CATCTGAGGCCACCTCAGCCTGG - Intergenic
943491278 2:188558719-188558741 CATCTGAGACCACCTCAACCTGG - Intronic
943558176 2:189430382-189430404 GGCCTGAGGTCACCTCACCCAGG + Intergenic
943565255 2:189509266-189509288 CATCTGAGGCCACCTCAGCCTGG - Intergenic
943620315 2:190141078-190141100 CCTCTGAGACCACCTCAGCCTGG + Intronic
943871786 2:193008922-193008944 TATCTGAGAACACCTCAGCCTGG + Intergenic
944920938 2:204412522-204412544 CATCTGAGGCCACCTCAGCCTGG - Intergenic
946574345 2:221057839-221057861 CATCTGAGACCACCTCAACCTGG + Intergenic
946968557 2:225066846-225066868 CATCTGAGACCACCTCAACCTGG - Intergenic
947054511 2:226085253-226085275 CATCTGAGTCCACCTCAACCTGG + Intergenic
947276365 2:228396588-228396610 GATCTGAGACCACCTCAGCCTGG + Intergenic
947683684 2:232061313-232061335 TCTTTGAGGACACCTAAGCCAGG - Intronic
947724583 2:232388816-232388838 GCCCTGGGGAGACCTCATCCTGG - Intergenic
948837619 2:240633412-240633434 CATCTGAGACCACCTCAACCTGG - Intergenic
1169985292 20:11436745-11436767 CATCTGAGGCCACCTCAGCCTGG + Intergenic
1170710687 20:18787678-18787700 CCTCTGAGACCACCTCAGCCTGG + Intergenic
1172380238 20:34483579-34483601 CATCTGAGAACACCTCAGCCTGG + Intronic
1176078192 20:63258680-63258702 GCTCTGCGGACAGCTCTGCCGGG - Intronic
1176103910 20:63376855-63376877 GCTCTGAGGACACCTCAACCTGG + Intronic
1176131074 20:63497099-63497121 GCTAGGAGGTCACCTCATCCAGG + Intronic
1177236211 21:18392458-18392480 CATCTGAGATCACCTCAACCTGG + Intronic
1177339858 21:19784561-19784583 CATCTGAGGCCACCTCAGCCTGG + Intergenic
1177599147 21:23288501-23288523 CATCTGAGACCACCTCAACCTGG - Intergenic
1179503355 21:41823520-41823542 CCTCTGGGGAAACCACAACCCGG + Intronic
1182797717 22:33003458-33003480 CATCTGAGACCACCTCAACCTGG - Intronic
949450722 3:4181922-4181944 GCTCTGAAGACTCCAGAACCTGG + Intronic
950271682 3:11620934-11620956 GCTCTCTGGACACCCCACCCAGG - Intronic
950455832 3:13092225-13092247 GCTCTGAGGACACCGTATCACGG + Intergenic
950853202 3:16082315-16082337 CATCTGAGACCACCTCAACCTGG + Intergenic
951192367 3:19785734-19785756 CATCTGAGAACACCTCAGCCTGG - Intergenic
951359035 3:21702858-21702880 CATCTGAGACCACCTCAACCTGG + Intronic
954866117 3:53731516-53731538 GCCCTGAGGCCACCTGATCCTGG - Intronic
955323020 3:57987951-57987973 GCTCTGAGAACACCTAGACATGG + Intergenic
956246368 3:67187354-67187376 CATCTGAGACCACCTCAACCTGG + Intergenic
956391560 3:68779025-68779047 CATCTGAGACCACCTCAACCTGG - Intronic
956546460 3:70408598-70408620 CATCTGAGGTCACCTCAGCCTGG + Intergenic
956909940 3:73807019-73807041 CATCTGAGGTCACCTCAGCCTGG - Intergenic
957105735 3:75884312-75884334 CATCTGAGACCACCTCAACCTGG + Intergenic
957276008 3:78092655-78092677 CATCTGAGAACACCTCAGCCTGG - Intergenic
957557602 3:81781399-81781421 CCTCTGAGACCACCTCCACCTGG + Intergenic
957557613 3:81781463-81781485 CCTCTGAGACCACCTCCACCTGG + Intergenic
957557625 3:81781527-81781549 CCTCTGAGACCACCTCCACCTGG + Intergenic
957762261 3:84573351-84573373 CATCTGAGAACACCTCAGCCTGG + Intergenic
957870952 3:86090074-86090096 CATCTGAGACCACCTCAACCTGG + Intergenic
958577634 3:95973385-95973407 CATCTGAGAACACCTCAACCTGG - Intergenic
961809046 3:129510942-129510964 GCTGAGAGGACACCTCCTCCAGG - Intronic
962522768 3:136212464-136212486 ACTCTGTGGACCCCTCTACCTGG - Intergenic
962646500 3:137445705-137445727 TATCTGAGGCCACCTCAGCCTGG + Intergenic
962689289 3:137877629-137877651 CATCTGAGACCACCTCAACCTGG - Intergenic
963363311 3:144303896-144303918 CATCTGAGACCACCTCAACCTGG + Intergenic
963878416 3:150501836-150501858 CATCTGAGAACACCTCAGCCTGG + Intergenic
964154049 3:153563653-153563675 CATCTGAGATCACCTCAACCTGG - Intergenic
964324615 3:155533031-155533053 CATCTGAGACCACCTCAACCTGG - Intronic
964456954 3:156879243-156879265 CATCTGAGACCACCTCAACCTGG - Intronic
966554109 3:181239625-181239647 GCTTTGAGGACATCTCAGGCTGG + Intergenic
967614468 3:191548003-191548025 CATCTGAGACCACCTCAACCTGG + Intergenic
967622648 3:191651555-191651577 TCTCTGAGACCACCTCAGCCTGG + Intergenic
969072506 4:4550842-4550864 CATCTGAGGCCACCTCAGCCTGG - Intergenic
969875545 4:10133355-10133377 GCCCTGAGGACACCACAGCCAGG + Intergenic
970127716 4:12832975-12832997 CATCTGAGAACACCTCAGCCTGG + Intergenic
970349563 4:15188450-15188472 CATCTGAGGCCACCTCAGCCTGG + Intergenic
970401096 4:15718698-15718720 GCTCTGAGGACCCCAGCACCGGG - Intronic
970773788 4:19648271-19648293 CATCTGAGACCACCTCAACCTGG + Intergenic
970987713 4:22177404-22177426 TATCTGAGACCACCTCAACCTGG + Intergenic
971119558 4:23688888-23688910 CCTCTGAGTCCACCTCAGCCTGG - Intergenic
971354966 4:25886968-25886990 GCTCTGAGCCCACTTCCACCTGG - Intronic
972613808 4:40679394-40679416 GCTCAGAGGACACCCCCACGAGG + Intergenic
972887585 4:43510963-43510985 CATCTGAGATCACCTCAACCTGG + Intergenic
973330962 4:48909941-48909963 GCTCTGAGGTCACCTCCTCGTGG + Intergenic
973872642 4:55181698-55181720 GCTCTGATGACGACTCAGCCTGG - Intergenic
974071346 4:57127047-57127069 CATCTGAGACCACCTCAACCTGG - Intergenic
974318024 4:60307073-60307095 CCTCTGAGACCACCTCAGCCTGG + Intergenic
974357241 4:60828559-60828581 GGTCTGAGGACACCCTAACATGG - Intergenic
974724109 4:65777093-65777115 CATCTGAGACCACCTCAACCTGG - Intergenic
974952271 4:68597604-68597626 CATCTGAGTCCACCTCAACCTGG - Intronic
975302137 4:72802519-72802541 CATCTGAGACCACCTCAACCTGG + Intergenic
976051033 4:81011792-81011814 CATCTGAGAACACCTCAACCTGG - Intergenic
976405702 4:84658773-84658795 TGTCTGAGAACACCTCAGCCTGG + Intergenic
976715567 4:88119546-88119568 CATCTGAGACCACCTCAACCTGG - Intronic
977511961 4:97973194-97973216 CATCTGAGGCCACCTCAGCCTGG - Intronic
977821139 4:101473518-101473540 CATCTGAGGCCACCTCAGCCTGG - Intronic
978309013 4:107364901-107364923 CCTCTGAGGCCACCTCAGCCTGG - Intergenic
979059915 4:116044347-116044369 CCTCTGAGAACACCTCAGCCTGG + Intergenic
979343501 4:119557075-119557097 GCACTGAGGTCACCTCTACCAGG + Intronic
979416674 4:120449514-120449536 GATCTGAGGACTCCTCTACCAGG + Intergenic
979966803 4:127086029-127086051 CATCTGAGACCACCTCAACCTGG - Intergenic
979986652 4:127324434-127324456 CATCTGAGGCCCCCTCAACCTGG - Intergenic
980282878 4:130742974-130742996 CCTCTGAGACCACCTCAGCCTGG - Intergenic
980646029 4:135643513-135643535 CATCTGAGACCACCTCAACCGGG - Intergenic
981343253 4:143647083-143647105 CATCTGAGACCACCTCAACCTGG - Intronic
981359553 4:143830997-143831019 CATCTGAGGCCACCTCAGCCTGG - Intergenic
981820449 4:148880917-148880939 CATCTGAGACCACCTCAACCTGG + Intergenic
981829565 4:148984750-148984772 CATCTGAGACCACCTCAACCTGG - Intergenic
981872835 4:149507441-149507463 CATCTGAGATCACCTCAACCTGG - Intergenic
982019562 4:151190006-151190028 CATCTGAGAACACCTCAGCCTGG - Intronic
982301115 4:153880419-153880441 CCTCTGAGACCACCTCAGCCTGG - Intergenic
983340413 4:166454154-166454176 CATCTGAGACCACCTCAACCTGG - Intergenic
984026242 4:174547020-174547042 CATCTGAGAACACCTCAGCCTGG - Intergenic
985512542 5:320868-320890 TCCCTGGGGACACCTCAGCCTGG - Intronic
986138357 5:5005130-5005152 CCTCTGAGACCACCTCAGCCTGG - Intergenic
987461919 5:18222750-18222772 CATCTGAGGCCACCTCAGCCTGG - Intergenic
987851655 5:23362625-23362647 TATCTGAGAACACCTCAGCCTGG + Intergenic
988310403 5:29549272-29549294 TATCTGAGACCACCTCAACCTGG + Intergenic
989311779 5:40027174-40027196 CATCTGAGACCACCTCAACCTGG + Intergenic
989726941 5:44597972-44597994 CATCTGAGACCACCTCAACCTGG + Intergenic
990213847 5:53509049-53509071 CATCTGAGAACACCTCAGCCTGG + Intergenic
991340416 5:65602376-65602398 CCTCTGAGACCACCTCAGCCTGG + Intronic
991586965 5:68211444-68211466 TATCTGAGACCACCTCAACCTGG + Intergenic
992310853 5:75498001-75498023 CATCTGAGGCCACCTCACCCTGG - Intronic
993690625 5:90995762-90995784 CATCTGAGGCCACCTCAGCCTGG - Intronic
993985835 5:94595967-94595989 CATCTGAGAACACCTCAGCCTGG + Intronic
994271598 5:97783518-97783540 CATCTGAGAACACCTCAGCCTGG + Intergenic
994285077 5:97955204-97955226 CATCTGAGAACACCTCAGCCTGG - Intergenic
994553096 5:101261646-101261668 CATCTGAGGCCACCTCAGCCTGG - Intergenic
994813826 5:104557650-104557672 CATCTGAGACCACCTCAACCTGG + Intergenic
994916174 5:105982682-105982704 GCTCTGAGGATGGCTCAACACGG + Intergenic
996453792 5:123656954-123656976 CCTCTGAGACCACCTCAGCCTGG + Intergenic
997088400 5:130827615-130827637 TCTCTGAGACCACCTCAGCCTGG + Intergenic
997274712 5:132574886-132574908 CATCTGAGACCACCTCAACCTGG + Intronic
998144448 5:139718779-139718801 CATCTGAGACCACCTCAACCTGG - Intergenic
999068250 5:148715360-148715382 CATCTGAGACCACCTCAACCTGG - Intergenic
999398555 5:151247014-151247036 GCTCTGAGGTAACCCAAACCAGG + Intronic
999669461 5:153945823-153945845 CCTCTGAGACCACCTCATCCTGG + Intergenic
1000580912 5:163034634-163034656 CCTCTGAGACCACCTCAGCCTGG - Intergenic
1001936198 5:175707735-175707757 GCTCTGTGGCCACCTCAGCCTGG + Intergenic
1004278452 6:14258686-14258708 TACCTGAGGACACCTCAACCAGG + Intergenic
1004750552 6:18557808-18557830 GCTCTGAGGAAGTCTCTACCAGG - Intergenic
1005180109 6:23095063-23095085 CATCTGAGGCCACCTCAACCTGG - Intergenic
1005227101 6:23655755-23655777 GCTCTGACGGCACCACATCCAGG + Intergenic
1006038725 6:31235532-31235554 GCTCTGGCGACCCTTCAACCTGG + Intergenic
1006062888 6:31438650-31438672 CATCTGAGGCCACCTCAGCCTGG - Intergenic
1007697156 6:43741035-43741057 CCTCTGAGGACCCCTCAGCAGGG - Intergenic
1009637035 6:66279945-66279967 CATCTGAGACCACCTCAACCTGG - Intergenic
1009723554 6:67507020-67507042 CATCTGAGACCACCTCAACCTGG + Intergenic
1012029136 6:94036445-94036467 CATCTGAGGCCACCTCACCCTGG - Intergenic
1012213838 6:96557547-96557569 CATCTGAGATCACCTCAACCTGG + Intergenic
1013194929 6:107836647-107836669 GCTGTGGTGACACCTCAAACAGG + Intergenic
1013438539 6:110138542-110138564 GCTCTCAGGACACCGGAAGCGGG + Intronic
1013716500 6:112968653-112968675 CTTCTGAGGCCACCTCAGCCTGG + Intergenic
1013884576 6:114946394-114946416 GGTCTGAGACCACCTCAGCCTGG + Intergenic
1014067758 6:117146517-117146539 TCTCTGAGATCACCTCAGCCAGG + Intergenic
1015901620 6:138074094-138074116 CCTCTGAGGTCACCTCAGCCTGG - Intergenic
1016020653 6:139233975-139233997 CATCTGAGGTCACCTCAGCCTGG - Intergenic
1016106676 6:140171918-140171940 TATCTGAGGCCACCTCAGCCTGG + Intergenic
1016420108 6:143874235-143874257 CATCTGAGATCACCTCAACCTGG + Intronic
1016540501 6:145159020-145159042 CATCTGAGAACACCTCAGCCTGG - Intergenic
1016643409 6:146377367-146377389 CATCTGAGACCACCTCAACCTGG - Intronic
1016649681 6:146449146-146449168 CATCTGAGACCACCTCAACCTGG + Intergenic
1017016176 6:150101253-150101275 GCTGTGGGGAGACCTCAGCCTGG + Intergenic
1017841597 6:158226904-158226926 GCTCTCAGGACACCTCGAAAGGG + Intergenic
1018514225 6:164561460-164561482 CATCTGAGACCACCTCAACCTGG - Intergenic
1018922786 6:168187046-168187068 TCTCTGAGTCCACCTCAGCCTGG + Intergenic
1019508490 7:1405314-1405336 GCTCTGAGGACCACCCACCCAGG + Intergenic
1020537952 7:9424940-9424962 CATCTGAGAACACCTCAGCCTGG + Intergenic
1020696443 7:11419789-11419811 CATCTGAGAACACCTCAGCCTGG - Intronic
1020959677 7:14787064-14787086 GCTCTCAGGACACCCAAACGGGG - Intronic
1021431096 7:20559926-20559948 GCTCTCAGGAGACCTAAAGCGGG + Intergenic
1021646838 7:22797056-22797078 CCTCTGAGACCACCTCAGCCTGG + Intergenic
1023060352 7:36320733-36320755 CATCTGAGACCACCTCAACCTGG - Intergenic
1023659830 7:42460185-42460207 GCTCTGAGGCCACCTTAATAAGG + Intergenic
1023866784 7:44242158-44242180 GGTCTGAGGCCATCTCCACCAGG + Intronic
1024203638 7:47132507-47132529 AATCTGAGTACACCTCAAACAGG - Intergenic
1025122543 7:56317473-56317495 GCTCTGGTGACCCTTCAACCTGG - Intergenic
1027953826 7:84855054-84855076 CCTCTGAGACCACCTCAGCCTGG + Intergenic
1028289210 7:89044602-89044624 CATCTGAGACCACCTCAACCTGG - Intronic
1028751084 7:94383701-94383723 AATCTGAGGAGACGTCAACCAGG + Intergenic
1028780372 7:94728752-94728774 GCTCTGGTGACCCTTCAACCTGG + Intergenic
1028814565 7:95129716-95129738 CATCTGAGGACACCTCAGCCTGG - Intronic
1030966985 7:116005373-116005395 CCTCTGAGACCACCTCATCCTGG - Intronic
1031275307 7:119713356-119713378 CATCTGAGAACACCTCAGCCTGG + Intergenic
1031301539 7:120067475-120067497 CATCTGAGGCCACCTCAGCCTGG - Intergenic
1031397002 7:121285674-121285696 CCTCTGAGACCACCTCAGCCTGG + Intronic
1031790209 7:126093083-126093105 TATCTGAGACCACCTCAACCTGG + Intergenic
1031806907 7:126317760-126317782 CATCTGAGAACACCTCATCCTGG + Intergenic
1031807531 7:126326578-126326600 CATCTGAGACCACCTCAACCTGG - Intergenic
1032430370 7:131856097-131856119 CATCTGAGACCACCTCAACCTGG - Intergenic
1033905285 7:146194013-146194035 CATCTGAGACCACCTCAACCTGG + Intronic
1035245983 7:157562157-157562179 GCTCTGGGGACAGCTCGCCCAGG + Intronic
1036461912 8:8960851-8960873 CATCTGAGGCCACCTCAGCCTGG + Intergenic
1037117744 8:15246743-15246765 CATCTGAGAACACCTCAGCCTGG - Intergenic
1037269823 8:17114619-17114641 GCTCTGAGGACACCAGCACTTGG - Intronic
1037995089 8:23346370-23346392 GCTCTGAGGACCACACATCCTGG - Intronic
1038733826 8:30151338-30151360 GCTCTGATGACTCTTCGACCTGG + Intronic
1039309149 8:36297115-36297137 CCTCTGAGACCACCTCAACCTGG - Intergenic
1040540124 8:48346378-48346400 CATCTGAGACCACCTCAACCTGG - Intergenic
1041007701 8:53511250-53511272 GCTCTGTGGAAACTTCAGCCTGG + Intergenic
1041163931 8:55072641-55072663 GCTCTGAGGACAGATAAAGCTGG - Intergenic
1042646489 8:70992783-70992805 GCTGTGGGTACACCTCAGCCTGG - Intergenic
1043030623 8:75129962-75129984 CATCTGAGACCACCTCAACCTGG - Intergenic
1043262621 8:78220889-78220911 CATCTGAGACCACCTCAACCTGG + Intergenic
1043510419 8:80945442-80945464 CATCTGAGATCACCTCAACCTGG - Intergenic
1045207319 8:100056089-100056111 CGTCTGAGACCACCTCAACCAGG - Intronic
1046226419 8:111286132-111286154 CATCTGAGGCCACCTCAGCCTGG + Intergenic
1046640115 8:116720715-116720737 CCTCTGAGATCACCTCAGCCTGG - Intronic
1047106723 8:121739595-121739617 GCTTTAAGGAAAGCTCAACCAGG - Intergenic
1048189341 8:132273888-132273910 CATCTGAGACCACCTCAACCTGG + Intronic
1048537761 8:135313405-135313427 CATCTGAGGCCACCTCAGCCTGG + Intergenic
1049243169 8:141548942-141548964 GCTCTGAGGAAGCCTCATGCTGG - Intergenic
1050155896 9:2666193-2666215 TGTCTGAGACCACCTCAACCTGG - Intergenic
1050581434 9:7061612-7061634 GCTCTGAGGAGCCCACAGCCAGG - Intronic
1052382647 9:27788525-27788547 CATCTGAGACCACCTCAACCTGG - Intergenic
1052580587 9:30349589-30349611 GCTCTGAGGAGACCTGAAGTGGG + Intergenic
1056283851 9:85068808-85068830 CATCTGAGACCACCTCAACCTGG - Intergenic
1057009018 9:91585076-91585098 GCTCTGAGAACACCCAAACCTGG - Intronic
1058279761 9:103099322-103099344 CAACTGAGAACACCTCAACCTGG + Intergenic
1058809930 9:108629753-108629775 CATCTGAGACCACCTCAACCTGG - Intergenic
1059674830 9:116528204-116528226 CATCTGAGACCACCTCAACCTGG - Intronic
1060088312 9:120721133-120721155 TCTCTGAGGAGACCAAAACCGGG + Intergenic
1060221492 9:121766340-121766362 GCTCTGAGGACACAGCCATCTGG - Intronic
1061098380 9:128473242-128473264 CCTCTGAGGAGACCTCATCATGG + Intronic
1061250912 9:129425928-129425950 GCTCTGGGGACACCTGTAACTGG - Intergenic
1061818559 9:133209903-133209925 GTTCTGAGGACAGCACAGCCAGG - Intergenic
1061852828 9:133425893-133425915 GCATTTAGGACACCCCAACCAGG - Intronic
1062241894 9:135545459-135545481 GTTCTGAGGACAGCACAGCCAGG + Intergenic
1062462419 9:136667467-136667489 GCTCTCAGGAAGCCTCACCCGGG + Intronic
1062601944 9:137322319-137322341 GCTCTGCCGACGCCTCACCCTGG + Intronic
1062601952 9:137322351-137322373 TCTCTGCCGACACCTCACCCCGG + Intronic
1062601970 9:137322423-137322445 GCTCTGCCGACACCTCACCCCGG + Intronic
1062601980 9:137322459-137322481 GCTCTGCCGACACCTCACCCCGG + Intronic
1062601989 9:137322494-137322516 GCTCTGCCGACACCTCACCCCGG + Intronic
1062601998 9:137322529-137322551 GCTCTGCCGACACCTCAACCCGG + Intronic
1062602006 9:137322564-137322586 GCTCTGCCGACACCTCACCCCGG + Intronic
1062602015 9:137322599-137322621 GCTCTGCCGACACCTCACCCCGG + Intronic
1062602024 9:137322634-137322656 GCTCTGCCGACACCTCACCCCGG + Intronic
1062602083 9:137322814-137322836 GCTCTGCCGACACCCCACCCCGG + Intronic
1062602095 9:137322850-137322872 GCTCTGCCGACACCCCACCCCGG + Intronic
1062602107 9:137322886-137322908 GCTCTGCCGACACCCCACCCCGG + Intronic
1062602119 9:137322922-137322944 GCTCTGCCGACACCCCACCCCGG + Intronic
1062602131 9:137322958-137322980 GCTCTGCCGACACCCCACCCCGG + Intronic
1062602234 9:137323246-137323268 GCTCTGCCGACACCCCACCCCGG + Intronic
1062602271 9:137323354-137323376 GCTCTGCCGACACCCCACCCCGG + Intronic
1062602283 9:137323390-137323412 GCTCTGCCGACACCCCACCCCGG + Intronic
1062602295 9:137323426-137323448 GCTCTGCCGACACCCCACCCCGG + Intronic
1062602319 9:137323498-137323520 GATCTGCCGACACCTCACCCCGG + Intronic
1062602329 9:137323534-137323556 GATCTGCCGACACCTCACCCCGG + Intronic
1062602339 9:137323570-137323592 GCTCTGCCGACACCTCACCCTGG + Intronic
1187013587 X:15304495-15304517 GCACTGAGAAAACCTGAACCCGG + Intronic
1187321498 X:18242520-18242542 TCTCTAAGGACCCTTCAACCTGG - Exonic
1188865101 X:35304841-35304863 CCTCTGAGACTACCTCAACCTGG - Intergenic
1189280745 X:39818818-39818840 GCTCTGAGAAAGCCTCAGCCAGG + Intergenic
1189331182 X:40145890-40145912 GCTCCGGGGTCACCTCGACCGGG + Intronic
1189553178 X:42114233-42114255 CATCTGAGAACACCTCAACCTGG + Intergenic
1189751954 X:44231401-44231423 GCTCTGAGAAAGTCTCAACCAGG - Intronic
1191656478 X:63604282-63604304 CATCTGAGACCACCTCAACCTGG - Intergenic
1193316612 X:80072275-80072297 CATCTGAGACCACCTCAACCTGG + Intergenic
1193482353 X:82043554-82043576 CCTCTGAGATCACCTCAGCCTGG - Intergenic
1193529935 X:82643838-82643860 CATCTGAGGCCACCTCAGCCTGG + Intergenic
1193678299 X:84483960-84483982 CATCTGAGAACACCTCAGCCTGG + Intronic
1193795209 X:85865709-85865731 CATCTGAGGCCACCTCAGCCTGG - Intronic
1193911348 X:87310223-87310245 TATCTGAGAACACCTCAGCCTGG + Intergenic
1193988340 X:88274845-88274867 CATCTGAGAACACCTCAGCCTGG - Intergenic
1194034431 X:88853630-88853652 CATCTGAGACCACCTCAACCTGG - Intergenic
1194043418 X:88971284-88971306 CATCTGAGGCCACCTCAGCCTGG + Intergenic
1194169393 X:90563554-90563576 TATCTGAGGCCACCTCAGCCTGG - Intergenic
1194779755 X:98010323-98010345 CCTCTGAGACCACCTCAGCCTGG - Intergenic
1194876876 X:99200619-99200641 TATCTGAGAACACCTCAGCCTGG - Intergenic
1194941428 X:100015753-100015775 GATCTGAGACCACCTCAGCCTGG - Intergenic
1195608439 X:106835773-106835795 CATCTGAGACCACCTCAACCTGG + Intronic
1196169712 X:112574201-112574223 CATCTGAGAACACCTCAGCCTGG - Intergenic
1197426551 X:126304440-126304462 CATCTGAGGCCACCTCAGCCTGG - Intergenic
1197455290 X:126671015-126671037 GGTCTCTGGACACCTCAAACAGG + Intergenic
1197642803 X:128985542-128985564 TATCTGAGGCCACCTCAGCCTGG - Intergenic
1197914475 X:131520421-131520443 CCTCTGAGATCACCTCAGCCTGG - Intergenic
1198976096 X:142337799-142337821 GCTCTGAGGACTCCGCAAAAAGG + Intergenic
1199060634 X:143351522-143351544 CATCTGAGACCACCTCAACCTGG + Intergenic
1199472437 X:148209868-148209890 CATCTGAGACCACCTCAACCTGG - Intergenic
1200236530 X:154470383-154470405 GCTCTGGGGACATCCCAACCTGG + Intronic
1200515634 Y:4141328-4141350 TATCTGAGGCCACCTCAGCCTGG - Intergenic
1201439674 Y:13994177-13994199 GCTCGGAGGCCTCCACAACCAGG + Intergenic
1201444897 Y:14048531-14048553 GCTCGGAGGCCTCCACAACCAGG - Intergenic
1202091301 Y:21193759-21193781 CATCTGAGACCACCTCAACCTGG - Intergenic