ID: 1176104284

View in Genome Browser
Species Human (GRCh38)
Location 20:63378488-63378510
Sequence GAAATGGGCATCAGAAATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176104284_1176104294 29 Left 1176104284 20:63378488-63378510 CCATTATTTCTGATGCCCATTTC No data
Right 1176104294 20:63378540-63378562 TGCATTAGGAAATAAGGAACGGG No data
1176104284_1176104291 15 Left 1176104284 20:63378488-63378510 CCATTATTTCTGATGCCCATTTC No data
Right 1176104291 20:63378526-63378548 TACTGGAATTTATCTGCATTAGG No data
1176104284_1176104295 30 Left 1176104284 20:63378488-63378510 CCATTATTTCTGATGCCCATTTC No data
Right 1176104295 20:63378541-63378563 GCATTAGGAAATAAGGAACGGGG No data
1176104284_1176104287 -2 Left 1176104284 20:63378488-63378510 CCATTATTTCTGATGCCCATTTC No data
Right 1176104287 20:63378509-63378531 TCTCACCCCACAGAAATTACTGG No data
1176104284_1176104293 28 Left 1176104284 20:63378488-63378510 CCATTATTTCTGATGCCCATTTC No data
Right 1176104293 20:63378539-63378561 CTGCATTAGGAAATAAGGAACGG No data
1176104284_1176104292 23 Left 1176104284 20:63378488-63378510 CCATTATTTCTGATGCCCATTTC No data
Right 1176104292 20:63378534-63378556 TTTATCTGCATTAGGAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176104284 Original CRISPR GAAATGGGCATCAGAAATAA TGG (reversed) Intergenic
No off target data available for this crispr