ID: 1176104289

View in Genome Browser
Species Human (GRCh38)
Location 20:63378515-63378537
Sequence TAAATTCCAGTAATTTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176104289_1176104292 -4 Left 1176104289 20:63378515-63378537 CCCACAGAAATTACTGGAATTTA No data
Right 1176104292 20:63378534-63378556 TTTATCTGCATTAGGAAATAAGG No data
1176104289_1176104293 1 Left 1176104289 20:63378515-63378537 CCCACAGAAATTACTGGAATTTA No data
Right 1176104293 20:63378539-63378561 CTGCATTAGGAAATAAGGAACGG No data
1176104289_1176104294 2 Left 1176104289 20:63378515-63378537 CCCACAGAAATTACTGGAATTTA No data
Right 1176104294 20:63378540-63378562 TGCATTAGGAAATAAGGAACGGG No data
1176104289_1176104295 3 Left 1176104289 20:63378515-63378537 CCCACAGAAATTACTGGAATTTA No data
Right 1176104295 20:63378541-63378563 GCATTAGGAAATAAGGAACGGGG No data
1176104289_1176104298 14 Left 1176104289 20:63378515-63378537 CCCACAGAAATTACTGGAATTTA No data
Right 1176104298 20:63378552-63378574 TAAGGAACGGGGACCGGGCCTGG No data
1176104289_1176104296 8 Left 1176104289 20:63378515-63378537 CCCACAGAAATTACTGGAATTTA No data
Right 1176104296 20:63378546-63378568 AGGAAATAAGGAACGGGGACCGG No data
1176104289_1176104297 9 Left 1176104289 20:63378515-63378537 CCCACAGAAATTACTGGAATTTA No data
Right 1176104297 20:63378547-63378569 GGAAATAAGGAACGGGGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176104289 Original CRISPR TAAATTCCAGTAATTTCTGT GGG (reversed) Intergenic
No off target data available for this crispr