ID: 1176104291

View in Genome Browser
Species Human (GRCh38)
Location 20:63378526-63378548
Sequence TACTGGAATTTATCTGCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176104285_1176104291 0 Left 1176104285 20:63378503-63378525 CCCATTTCTCACCCCACAGAAAT No data
Right 1176104291 20:63378526-63378548 TACTGGAATTTATCTGCATTAGG No data
1176104284_1176104291 15 Left 1176104284 20:63378488-63378510 CCATTATTTCTGATGCCCATTTC No data
Right 1176104291 20:63378526-63378548 TACTGGAATTTATCTGCATTAGG No data
1176104286_1176104291 -1 Left 1176104286 20:63378504-63378526 CCATTTCTCACCCCACAGAAATT No data
Right 1176104291 20:63378526-63378548 TACTGGAATTTATCTGCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176104291 Original CRISPR TACTGGAATTTATCTGCATT AGG Intergenic
No off target data available for this crispr