ID: 1176104293

View in Genome Browser
Species Human (GRCh38)
Location 20:63378539-63378561
Sequence CTGCATTAGGAAATAAGGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176104290_1176104293 0 Left 1176104290 20:63378516-63378538 CCACAGAAATTACTGGAATTTAT No data
Right 1176104293 20:63378539-63378561 CTGCATTAGGAAATAAGGAACGG No data
1176104286_1176104293 12 Left 1176104286 20:63378504-63378526 CCATTTCTCACCCCACAGAAATT No data
Right 1176104293 20:63378539-63378561 CTGCATTAGGAAATAAGGAACGG No data
1176104289_1176104293 1 Left 1176104289 20:63378515-63378537 CCCACAGAAATTACTGGAATTTA No data
Right 1176104293 20:63378539-63378561 CTGCATTAGGAAATAAGGAACGG No data
1176104285_1176104293 13 Left 1176104285 20:63378503-63378525 CCCATTTCTCACCCCACAGAAAT No data
Right 1176104293 20:63378539-63378561 CTGCATTAGGAAATAAGGAACGG No data
1176104288_1176104293 2 Left 1176104288 20:63378514-63378536 CCCCACAGAAATTACTGGAATTT No data
Right 1176104293 20:63378539-63378561 CTGCATTAGGAAATAAGGAACGG No data
1176104284_1176104293 28 Left 1176104284 20:63378488-63378510 CCATTATTTCTGATGCCCATTTC No data
Right 1176104293 20:63378539-63378561 CTGCATTAGGAAATAAGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176104293 Original CRISPR CTGCATTAGGAAATAAGGAA CGG Intergenic
No off target data available for this crispr