ID: 1176104297

View in Genome Browser
Species Human (GRCh38)
Location 20:63378547-63378569
Sequence GGAAATAAGGAACGGGGACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176104286_1176104297 20 Left 1176104286 20:63378504-63378526 CCATTTCTCACCCCACAGAAATT No data
Right 1176104297 20:63378547-63378569 GGAAATAAGGAACGGGGACCGGG No data
1176104290_1176104297 8 Left 1176104290 20:63378516-63378538 CCACAGAAATTACTGGAATTTAT No data
Right 1176104297 20:63378547-63378569 GGAAATAAGGAACGGGGACCGGG No data
1176104285_1176104297 21 Left 1176104285 20:63378503-63378525 CCCATTTCTCACCCCACAGAAAT No data
Right 1176104297 20:63378547-63378569 GGAAATAAGGAACGGGGACCGGG No data
1176104288_1176104297 10 Left 1176104288 20:63378514-63378536 CCCCACAGAAATTACTGGAATTT No data
Right 1176104297 20:63378547-63378569 GGAAATAAGGAACGGGGACCGGG No data
1176104289_1176104297 9 Left 1176104289 20:63378515-63378537 CCCACAGAAATTACTGGAATTTA No data
Right 1176104297 20:63378547-63378569 GGAAATAAGGAACGGGGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176104297 Original CRISPR GGAAATAAGGAACGGGGACC GGG Intergenic
No off target data available for this crispr