ID: 1176105159

View in Genome Browser
Species Human (GRCh38)
Location 20:63382432-63382454
Sequence TCCCCACCCATTTTACCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176105157_1176105159 -3 Left 1176105157 20:63382412-63382434 CCTGGGCAGGACCAGGAATCTCC No data
Right 1176105159 20:63382432-63382454 TCCCCACCCATTTTACCCCCAGG No data
1176105150_1176105159 23 Left 1176105150 20:63382386-63382408 CCTTCGGGTGGCATCAGGGCAGA No data
Right 1176105159 20:63382432-63382454 TCCCCACCCATTTTACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176105159 Original CRISPR TCCCCACCCATTTTACCCCC AGG Intergenic
No off target data available for this crispr