ID: 1176107321

View in Genome Browser
Species Human (GRCh38)
Location 20:63395596-63395618
Sequence GCAGGACGCAGCTCCAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176107312_1176107321 25 Left 1176107312 20:63395548-63395570 CCGGCTGGAGGGAAGGAGGGGGA No data
Right 1176107321 20:63395596-63395618 GCAGGACGCAGCTCCAGGCAGGG No data
1176107308_1176107321 27 Left 1176107308 20:63395546-63395568 CCCCGGCTGGAGGGAAGGAGGGG No data
Right 1176107321 20:63395596-63395618 GCAGGACGCAGCTCCAGGCAGGG No data
1176107310_1176107321 26 Left 1176107310 20:63395547-63395569 CCCGGCTGGAGGGAAGGAGGGGG No data
Right 1176107321 20:63395596-63395618 GCAGGACGCAGCTCCAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176107321 Original CRISPR GCAGGACGCAGCTCCAGGCA GGG Intergenic