ID: 1176107840

View in Genome Browser
Species Human (GRCh38)
Location 20:63397948-63397970
Sequence CTGAGCAGTGCCAGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176107834_1176107840 -10 Left 1176107834 20:63397935-63397957 CCAGAGCACCCTGCTGAGCAGTG No data
Right 1176107840 20:63397948-63397970 CTGAGCAGTGCCAGGCTGGAGGG No data
1176107833_1176107840 13 Left 1176107833 20:63397912-63397934 CCAGGATGGTCAAGAGAGGTCTT No data
Right 1176107840 20:63397948-63397970 CTGAGCAGTGCCAGGCTGGAGGG No data
1176107829_1176107840 25 Left 1176107829 20:63397900-63397922 CCCCGAAGCTAGCCAGGATGGTC No data
Right 1176107840 20:63397948-63397970 CTGAGCAGTGCCAGGCTGGAGGG No data
1176107830_1176107840 24 Left 1176107830 20:63397901-63397923 CCCGAAGCTAGCCAGGATGGTCA No data
Right 1176107840 20:63397948-63397970 CTGAGCAGTGCCAGGCTGGAGGG No data
1176107831_1176107840 23 Left 1176107831 20:63397902-63397924 CCGAAGCTAGCCAGGATGGTCAA No data
Right 1176107840 20:63397948-63397970 CTGAGCAGTGCCAGGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176107840 Original CRISPR CTGAGCAGTGCCAGGCTGGA GGG Intergenic
No off target data available for this crispr