ID: 1176109914

View in Genome Browser
Species Human (GRCh38)
Location 20:63406502-63406524
Sequence GGCCCTGGAGGGGCCCATGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 310}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176109914_1176109928 15 Left 1176109914 20:63406502-63406524 CCCACATGGGCCCCTCCAGGGCC 0: 1
1: 0
2: 4
3: 35
4: 310
Right 1176109928 20:63406540-63406562 ACTCAGTTACTGTAAGAAAAGGG 0: 1
1: 0
2: 1
3: 26
4: 249
1176109914_1176109930 25 Left 1176109914 20:63406502-63406524 CCCACATGGGCCCCTCCAGGGCC 0: 1
1: 0
2: 4
3: 35
4: 310
Right 1176109930 20:63406550-63406572 TGTAAGAAAAGGGCCCCAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 205
1176109914_1176109927 14 Left 1176109914 20:63406502-63406524 CCCACATGGGCCCCTCCAGGGCC 0: 1
1: 0
2: 4
3: 35
4: 310
Right 1176109927 20:63406539-63406561 CACTCAGTTACTGTAAGAAAAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1176109914_1176109929 24 Left 1176109914 20:63406502-63406524 CCCACATGGGCCCCTCCAGGGCC 0: 1
1: 0
2: 4
3: 35
4: 310
Right 1176109929 20:63406549-63406571 CTGTAAGAAAAGGGCCCCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176109914 Original CRISPR GGCCCTGGAGGGGCCCATGT GGG (reversed) Exonic
900114639 1:1023279-1023301 GGCTCTTGAGGGGTCCTTGTGGG + Intronic
900123418 1:1059160-1059182 GGCGCTGGTGGGTCCCAGGTTGG + Intergenic
900396315 1:2454592-2454614 GGCCCTGCAGGGTCCCAGGCAGG - Intronic
900582057 1:3414263-3414285 GGCCCTCGAGGGGACCTTGGAGG + Intronic
900602508 1:3509225-3509247 AGCCCTGGAGGAGCCGATGGTGG - Exonic
900955940 1:5886598-5886620 GGCCCTACAGGGTCCCATGTCGG + Intronic
901040168 1:6358778-6358800 GGCCGTGCAGGGGCCACTGTGGG - Intronic
901198499 1:7453611-7453633 GTCCCTGGAGGGGGACATGTGGG + Intronic
901199109 1:7456779-7456801 GACACAGCAGGGGCCCATGTGGG + Intronic
901473488 1:9473446-9473468 GGCCCTGGAGGGGACCATCCCGG - Intergenic
901530315 1:9848889-9848911 AGCCCTGGAGAGCCCCATGGTGG - Exonic
902184718 1:14716729-14716751 GGCCCTAGAGGGGAGGATGTAGG - Intronic
902250696 1:15153018-15153040 GGCCCAGGTGGGGCCCATTCCGG - Intronic
902715627 1:18270644-18270666 GGCCATGGAGGCGGCCATGTTGG + Intronic
903787355 1:25870241-25870263 AGACTTGGAGGGGCCCATGGAGG - Intronic
903928991 1:26851386-26851408 GGCCCTGGTGGGTCCGATGCAGG + Intronic
904829660 1:33298686-33298708 GGCCCTGGAGAGCCACAGGTGGG + Intronic
905028111 1:34865220-34865242 CCTCCTGGAGGGGCCCAGGTGGG - Intergenic
905478629 1:38246218-38246240 GGCCCTGGATGTGCCCAGGCTGG + Intergenic
908257649 1:62316165-62316187 GGTCCTGGATTGGGCCATGTGGG - Intronic
910692128 1:89975647-89975669 GGCTCTGCAGAGGCCCATCTAGG - Intergenic
912956079 1:114154791-114154813 CGCCCTGCAGGGGCCTATCTCGG + Intergenic
913519457 1:119631596-119631618 GGCCCAGGCGGGGCCCAAGCGGG - Intronic
916504226 1:165413510-165413532 GGCCCAGGAGGAGCCATTGTGGG - Intronic
916651730 1:166839778-166839800 GGGCCGGGAGGGGGCCAGGTGGG + Intronic
917929616 1:179814227-179814249 TGCCCTGGCGGGGGCCATGGGGG + Exonic
918070187 1:181128796-181128818 GGCCCAGCAGGGGCCTCTGTGGG + Intergenic
918261991 1:182804716-182804738 GGCTCTGGAGGGGCTCCTGTTGG - Intronic
919731535 1:200916343-200916365 GGCCCTGGAGCGGTCCCTGCAGG - Intergenic
919743526 1:200994643-200994665 GGCCCTGGAGAGCCTCATGAGGG - Intronic
920735528 1:208529814-208529836 GGTCCTGGGGGAGCCCATGCTGG - Intergenic
922551493 1:226497692-226497714 GGCCCTGGAGCCTCCCATGGAGG + Intergenic
922698678 1:227745289-227745311 GGCCCTGCAGGGGCCTCTGTGGG - Intronic
922767518 1:228163580-228163602 GGCCCTGGATGTGGCCATGGAGG - Intergenic
923546488 1:234927327-234927349 GGCCGTGGAGGAGACCCTGTTGG - Intergenic
923623198 1:235594507-235594529 GGCCGTGCAGGAGCCCATGGTGG + Intronic
924112616 1:240714746-240714768 AGCCCTGGAGGGGCGAGTGTTGG + Intergenic
1062925769 10:1314485-1314507 GGCCGTGGAAGGGCCGATGTGGG - Intronic
1063036444 10:2290765-2290787 GGCCCAGGTGGGCCCCAGGTCGG + Intergenic
1063486634 10:6426371-6426393 GGCCCTGGATGGGCCAGTGGAGG - Intergenic
1066694927 10:38069041-38069063 GGCTCTGCAGGGGCCCAGGGAGG + Intergenic
1067278095 10:44852000-44852022 GGCCCAGGATGGGCCCAGGATGG + Intergenic
1067295180 10:44971567-44971589 GGCCCTGGTGGGGGGCATGGGGG - Intronic
1067431724 10:46249831-46249853 GGCCCTGGACCCGCCCATGAAGG + Intergenic
1067528028 10:47050064-47050086 GGGCCTCGAGGGGCCCAGGCAGG - Intergenic
1069563992 10:69451324-69451346 GGCCCTAGAGGGGACCAAGAAGG - Intergenic
1069717669 10:70531382-70531404 GGCCCTGGAGGTTCTCATGAAGG - Exonic
1069945285 10:71981357-71981379 GGCTGGGGAGGGGCCCATGGAGG - Intronic
1070512882 10:77177121-77177143 GCCTCTGGAGAGACCCATGTTGG + Intronic
1070653387 10:78254080-78254102 CTTCCTGGAGGGGCCCATGCTGG + Intergenic
1070683441 10:78465054-78465076 GGCTTTGAAGGGGCCCATGGTGG + Intergenic
1070978197 10:80622619-80622641 GGCCCTGGAGGGTCTCATGGTGG + Intronic
1072821821 10:98565989-98566011 AGGCCTGGAGGGGAGCATGTTGG - Intronic
1075475404 10:122729587-122729609 GCCCCTGGAGAGGCCCACTTTGG + Intergenic
1075480805 10:122780219-122780241 GGCCCTGGCGAGGCCCACTTTGG + Intergenic
1076401525 10:130188631-130188653 GGCTGTGGATGGGCCCATATTGG + Intergenic
1076597917 10:131637398-131637420 GGCCCTGGAGGGGATCATGGCGG - Intergenic
1076814824 10:132909563-132909585 GGCCCTAGTGGGGCCCAGGGAGG - Intronic
1077014089 11:392382-392404 GCCCCTGCAGGGCCCCAGGTGGG + Intergenic
1077392178 11:2305201-2305223 AGCCCTGGGTGGGCCCATGGTGG + Intronic
1083430733 11:62612610-62612632 GGGCCTGGAGGGGGCGCTGTGGG + Exonic
1083926558 11:65810743-65810765 GGCACAGGAGGGCCCCATGGTGG + Intergenic
1085472595 11:76767797-76767819 GCCCCAGGAGGGGCCCAGGAAGG - Intergenic
1085524679 11:77157386-77157408 GGCCATGGTGAGGCCCAGGTGGG + Exonic
1087816456 11:102664109-102664131 GGACATGGAGGGGACCATGCTGG + Intergenic
1088733737 11:112707866-112707888 GCGCCTGGAGGGGGCCATGCTGG + Intergenic
1089195774 11:116693303-116693325 AGCCCTGGAGGAGCCACTGTGGG + Intergenic
1089288069 11:117420309-117420331 GGCCCTGGCGGGGCTCAGCTGGG + Intergenic
1089312785 11:117571105-117571127 AGCCCTGGTGGGGACGATGTCGG + Intronic
1090333553 11:125948436-125948458 GGCCTTGGAGAGGCCCTGGTGGG + Intergenic
1091991614 12:4960431-4960453 GGGCCTGGGGGGGCACATGTTGG - Intergenic
1092126316 12:6077436-6077458 GGCCGTGGAGGGGCTGCTGTTGG - Intronic
1095587076 12:43861177-43861199 GGTCCTGGAGGCAGCCATGTGGG + Intronic
1096193874 12:49636569-49636591 GGGCCTGGAGGGGGCTCTGTGGG - Exonic
1096308124 12:50496891-50496913 GGCCCAGGACGGGCCCCTGATGG + Intergenic
1096979042 12:55717986-55718008 AGCCCAGGAGGTGCCAATGTGGG - Intronic
1097187264 12:57202559-57202581 GGCCTGGGAGGGGCTCATGCGGG - Intronic
1101311633 12:103585990-103586012 GGCCTCTGAGGGGCCTATGTTGG + Intergenic
1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG + Intronic
1104430827 12:128714681-128714703 GGCCCTGGACAGGACCAGGTAGG - Intergenic
1104885281 12:132103887-132103909 GGCTCAGGAGGGGCCAATGCGGG - Intronic
1104983633 12:132584963-132584985 GGGCATGGGGGGGCTCATGTGGG - Exonic
1105624107 13:22096569-22096591 GGCTCTAGAGTGGCCCATTTCGG + Intergenic
1108019079 13:46107318-46107340 TGCCCTGTAGGGGCTCCTGTTGG + Intergenic
1112509043 13:99991989-99992011 GGCCTGGGAGGAGCCCAAGTTGG - Intergenic
1113660828 13:112105438-112105460 GGCGCTGGCGGGGCCGGTGTGGG + Intergenic
1113817518 13:113184692-113184714 AGCCCTGCAGGAGCCCATGCTGG + Intronic
1114656210 14:24316994-24317016 CGCCCTGGTGGGGCCCCTCTCGG + Exonic
1115510981 14:34137593-34137615 AGCCCTGGAGGCTCCCCTGTAGG - Intronic
1117753463 14:58947959-58947981 GGCACTGGAGGGGGCGCTGTGGG - Intergenic
1118930373 14:70234881-70234903 GGCAGTGGAGGGGCCCAGGGAGG - Intergenic
1119387023 14:74263868-74263890 GGACCCTGAGGGGCACATGTGGG + Intergenic
1121137176 14:91509799-91509821 GTCCCTGGAGCGGGCCATGCAGG - Exonic
1122037860 14:98961482-98961504 GGCCCTGGAGGGGGCCATTTTGG - Intergenic
1122370255 14:101225583-101225605 GGCCCCCGGGGGGCCCTTGTGGG - Intergenic
1122830858 14:104394922-104394944 GTCCCTGGAGGGTCCCAGGAAGG + Intergenic
1123008915 14:105337907-105337929 GCCCCTGGGGGTGCACATGTGGG - Intronic
1124056201 15:26242877-26242899 GGCCCTGGAAGGGTGCATGGGGG - Intergenic
1124165701 15:27323917-27323939 GGCCCTGGAAGAGCCCATGTGGG - Intronic
1124600520 15:31129467-31129489 GGCACTGGAGGCGGCCAGGTGGG - Intronic
1125894192 15:43288176-43288198 GGCCCTGGAGGAGCCAGGGTGGG + Intronic
1126449378 15:48789167-48789189 GGGCCTGGAGGGTCCCAGCTAGG - Intronic
1126518092 15:49557832-49557854 AGGCCTGTAGGGCCCCATGTGGG - Intronic
1127774327 15:62253616-62253638 TGCCCAGGAGGGGCCCAGTTAGG - Intergenic
1128773562 15:70301769-70301791 GTCCCTGGAGGGGCACAGCTTGG - Intergenic
1129256960 15:74339131-74339153 GGCCCTGGTGGGGCCCTTGATGG - Intronic
1129264639 15:74387191-74387213 GGCCCAGGATGGGCCCTTCTGGG - Intergenic
1129598366 15:76982556-76982578 GGCCCTGGCTGGGTCAATGTAGG - Intergenic
1129740081 15:77985872-77985894 GGACCTGCCGGGGCCCATGTTGG + Intronic
1129895882 15:79105464-79105486 TGCCCTGGAGGTGCCCATCCAGG - Intergenic
1130969684 15:88722104-88722126 AGCCCTGGAGGGGCCCAGAGAGG + Intergenic
1131122868 15:89833936-89833958 GGCCCAAGAGGGGCCCAGGCTGG + Exonic
1131445424 15:92494956-92494978 GGCCCAGCAGGTGCCAATGTGGG + Intronic
1132338859 15:101065623-101065645 AACCATGGAGGGGGCCATGTAGG - Exonic
1132627504 16:898517-898539 GGGCCTGGAGCAGCCCAGGTGGG + Intronic
1132704481 16:1237190-1237212 GGAGCTGGAGGGGCTCATGCAGG + Intergenic
1132707033 16:1249235-1249257 GGAGCTGGAGGGGCTCATGCAGG - Intergenic
1133018636 16:2956168-2956190 GCCCCTGGAGCTGCCCGTGTGGG + Intergenic
1133444767 16:5850746-5850768 GGCTCTGGAGTCGCCCTTGTGGG - Intergenic
1133750654 16:8722762-8722784 GACCCTGGATGGGCGCATCTGGG - Intronic
1133887808 16:9846914-9846936 GGCCTTGGAGGTGGCCATGGAGG + Intronic
1136399655 16:30010569-30010591 GGCCCTGCAGGGCCCCTTGGGGG - Intronic
1137625164 16:49903123-49903145 GGCCCTGGGTGGGCAGATGTAGG + Intergenic
1139635802 16:68257767-68257789 GGGCCTGGAGGGACGGATGTGGG + Intronic
1140245646 16:73245689-73245711 GGTTCTGGAAGGGCCCAGGTAGG - Intergenic
1141311147 16:82914217-82914239 GGCCCTGGGAGGGGCCATGATGG - Intronic
1141434314 16:83990643-83990665 GACCCTGCAGGGTCCCATGGGGG + Intronic
1141489262 16:84360889-84360911 GGCCCTGGTGTGGCCTATGAAGG + Intergenic
1142623952 17:1180562-1180584 CGCCCAGGAGGGGCACATGTGGG - Intronic
1144950118 17:18989421-18989443 GGCCCAGGAGGAGCCCAGATGGG - Intronic
1145976696 17:28988044-28988066 TGCCCTGGAGGGGCAGTTGTTGG + Intronic
1146399858 17:32494091-32494113 GGCCCTGGTGGGGGCCTTGGTGG + Exonic
1147170828 17:38617762-38617784 GGCCCTGCAGGTGCCCACGGAGG + Intergenic
1147311633 17:39599215-39599237 GCCCCTGGAGGGGCCCGCGCCGG - Intergenic
1148102890 17:45103470-45103492 GTCCCTGGCGGTGCCCATGCTGG + Intronic
1149685191 17:58531178-58531200 CTCCCTGGAGGTGCCCAGGTAGG - Intronic
1150649609 17:67001321-67001343 GGAGCTGGAGGGAGCCATGTGGG - Intronic
1151414424 17:73952388-73952410 CGCGCTGGAGGGGCCCAGGAGGG + Intergenic
1151467692 17:74298203-74298225 GGCCCTAGAGGGGCCCTTCTTGG - Intronic
1151711859 17:75811575-75811597 GGCCCTGTTGGGCCCCATTTAGG + Intronic
1151975301 17:77480860-77480882 GGGCCTGGATGGGCCCAAGCAGG + Intronic
1152034555 17:77864100-77864122 GGTCCTGGAGTGGCCCACGCCGG - Intergenic
1152093442 17:78259046-78259068 GGGCCTGGCTGGGCCCATGGTGG + Intergenic
1152382183 17:79947749-79947771 GGACCTGGTGGCGCCCATCTTGG - Exonic
1152573503 17:81130548-81130570 GGCGCTGGTGGGGCCCGTGTGGG - Intronic
1152587036 17:81193767-81193789 GGCCCTGGAGTGGCCCTTGGGGG - Intronic
1153201992 18:2656097-2656119 GGGCCTGGTGGGGCCTCTGTGGG + Exonic
1154502450 18:15003559-15003581 GGCCCAGGAGGGACCCGTGAGGG - Intergenic
1156449785 18:37260553-37260575 AGCCATGCAGCGGCCCATGTTGG - Intronic
1157966567 18:52215480-52215502 GGCTATGGAGGTGGCCATGTTGG + Intergenic
1160406003 18:78646802-78646824 GGGCCTGAAGGGTCCCATGAAGG - Intergenic
1160559673 18:79748376-79748398 GGGCCTGGGGGGACCCATGGAGG + Intronic
1161014931 19:1978795-1978817 GGCCCTGGAGGGGAGCGCGTGGG + Intronic
1161104534 19:2436847-2436869 GGCCCTGGAGGGGCCCTCACAGG - Intronic
1161590805 19:5128349-5128371 GGCCCAGGAGGGCCCCACCTGGG - Intronic
1161709752 19:5841445-5841467 GGCACTGGAGGGTCCAATGAGGG - Intergenic
1161973586 19:7596733-7596755 GGCGCTGGAGGGGGCTATGGAGG - Intronic
1162329470 19:10018747-10018769 GGGCCTGGTGGGGCCCCTGGAGG + Exonic
1163124860 19:15239333-15239355 GGCCCTGGAAGGTGCCATGCTGG - Intronic
1163546071 19:17942211-17942233 GGCCAGGGAGGGGTTCATGTTGG - Intronic
1163557092 19:17999010-17999032 GGCCCCAGCGGGGCCCATGGGGG + Exonic
1163860392 19:19739844-19739866 GGCCTTGGAAGAGCCCCTGTGGG + Intergenic
1164622026 19:29702231-29702253 GGCCTTGGAGCAGCCCATGCTGG - Intronic
1164760591 19:30725677-30725699 GGCCATGGGGATGCCCATGTTGG - Intergenic
1165076408 19:33282095-33282117 GGCACTAGAGGGGTCCATGTGGG + Intergenic
1165160491 19:33812963-33812985 GTCCCTGGGGGGGCCCAGGTGGG - Exonic
1165398128 19:35578651-35578673 GGTCCTGGTGGGGCCCAGGCAGG - Intergenic
1165895735 19:39139756-39139778 GGCACTGCAGGGGCCCAAGCTGG + Intronic
1166080538 19:40441572-40441594 GGCTCTGGTGGGGCCCGTGCAGG + Exonic
1166936050 19:46333606-46333628 GGCCCTGGAGGAACACAAGTAGG + Intronic
1167138712 19:47634348-47634370 GGACCAGGAGGAGGCCATGTTGG + Intronic
925073268 2:987946-987968 CGGCCTGGAGAGGCCCACGTGGG - Intronic
927485603 2:23486508-23486530 CGCTCTGGATGGGGCCATGTGGG + Intronic
927702665 2:25277624-25277646 TGCCATGGAGGGTCCCAAGTAGG - Intronic
927938001 2:27086231-27086253 GGCCCTGGAGGGGTTCTTGGGGG - Exonic
928387093 2:30879854-30879876 GGCCCTGGGGAGGCCTGTGTGGG + Intergenic
929898833 2:45984285-45984307 AGTCCTGGAGAGGACCATGTTGG + Intronic
929943577 2:46353359-46353381 GGCCCTGGACGGGCCCCTGCTGG - Intronic
931431466 2:62212151-62212173 GGCTCTGAAGGGGACCTTGTAGG + Intronic
932335993 2:70931703-70931725 GACCCTGGAGAGGCCCAGGCAGG - Intronic
932435542 2:71700824-71700846 GGCCCTGGTGGGGCCCCTTCCGG + Intergenic
933784005 2:85823896-85823918 GGCCTTGCAGGGGCCTATGCAGG + Intergenic
937156695 2:119724908-119724930 GGCCCTGGTGGGGCCCACAGTGG + Intergenic
937865016 2:126743916-126743938 GGGACTTGAGGGGCCCATGCTGG - Intergenic
938405624 2:131031725-131031747 GGCCCTAGAGGGGCCAGTGCTGG - Intronic
938501625 2:131833731-131833753 GGCCCAGGAGGGACCCATGAGGG - Intergenic
939712152 2:145535829-145535851 GGCTCTGGAGGGGGCCATGTAGG - Intergenic
941178961 2:162235200-162235222 GGCCGTGCAGGAGCCCATGGCGG - Intronic
942323407 2:174755338-174755360 GTCCCCTGAGGCGCCCATGTGGG + Intronic
947103838 2:226648298-226648320 GGCCGTGCAGGAGCCCATGGTGG - Intergenic
948528409 2:238587647-238587669 AGTCCTGGATGGGTCCATGTGGG - Intergenic
948888469 2:240895739-240895761 GGACATGGAGGTGCCCCTGTGGG - Exonic
1170316148 20:15043398-15043420 GACACTGGAGGGGCCTGTGTGGG - Intronic
1171002185 20:21425895-21425917 GGCCCCTGAGGGGCACATGTGGG + Intergenic
1173253682 20:41377742-41377764 AGCCCTGGACAGGCCCCTGTAGG - Intergenic
1174447780 20:50602164-50602186 GGCCCTCGAGGGGCCTCTGCAGG - Exonic
1175121322 20:56718281-56718303 TTCCCTGGAGGTGCCCATCTGGG + Intergenic
1176109914 20:63406502-63406524 GGCCCTGGAGGGGCCCATGTGGG - Exonic
1176122554 20:63460634-63460656 GGCCCAGGAGGGGCTTGTGTTGG - Intronic
1176220507 20:63967344-63967366 GGCCATGGTGGGGCTCATGCTGG - Intronic
1177792517 21:25735649-25735671 GGCCGCGGGGGGGCCCTTGTGGG - Intronic
1178493328 21:33067963-33067985 AGCCCAGGAGGGGGCCATGATGG - Intergenic
1179924832 21:44528693-44528715 GGGCCTGGAAGGGCCCCTGCAGG + Intronic
1180177845 21:46098755-46098777 GGGCCTGGCGGGGCCCTGGTGGG - Intronic
1181009443 22:20031988-20032010 GAGCCTGGAGGGGCTCATGGTGG - Intronic
1181559319 22:23690884-23690906 GTCCCAGGAGGGGCCCAGGCAGG - Exonic
1181601988 22:23958284-23958306 GGCCCTGGAGGAGCTGATGCAGG - Exonic
1181606521 22:23983023-23983045 GGCCCTGGAGGAGCTGATGCAGG + Exonic
1181645820 22:24231456-24231478 TGCCCTGGAGGTGCCCCTGGGGG - Exonic
1181689974 22:24553838-24553860 GGACCTAGAGGTGCTCATGTTGG + Intronic
1181694243 22:24585040-24585062 GGCCCTGGGGGTCCCCGTGTGGG - Intronic
1183423037 22:37723410-37723432 GGCCCTGGAGGTGTCCCTTTGGG - Exonic
1183883586 22:40857281-40857303 TCCCCTGGAGGGACCCAAGTTGG + Intronic
1184020374 22:41817087-41817109 TTCCCTGCAGTGGCCCATGTGGG - Intronic
1184066613 22:42125158-42125180 GTCTCTGGAGGGGCCCAAGGGGG + Intergenic
1184069081 22:42137310-42137332 GTCTCTGGAGGGGCCCAAGGGGG + Intergenic
1184130752 22:42515190-42515212 GGCCCTGAAGGGCCCCCTGCTGG - Exonic
1184140931 22:42577020-42577042 GGCCCTGAAGGGCCCCCTGCTGG - Intergenic
1184587361 22:45457050-45457072 GGCCCTGGAGGGGGCGAGGCAGG - Intergenic
1184687965 22:46104930-46104952 GGCTGTGGAGGGGCCCAGGAGGG - Intronic
1184979392 22:48085288-48085310 TGCCCTGTAGGGGCTCATGTGGG + Intergenic
1185109687 22:48894059-48894081 GACCCTGCAGGGGCCGATGTAGG + Intergenic
1185212472 22:49577948-49577970 TGCCCTGGTGGGGCCCAGGGTGG - Intronic
1185408875 22:50672620-50672642 GGCCCTGGAGGCTCCCGTATCGG - Intergenic
1185418030 22:50720628-50720650 GGCGCTGAAGGCGCCCAGGTTGG - Intergenic
950200108 3:11036664-11036686 GGCTGTGGCGTGGCCCATGTGGG + Intronic
950400932 3:12768867-12768889 GGCCCTGCAGGAGCCCATGGCGG + Intronic
953569117 3:44057501-44057523 GGCCCACGATGGGCCCGTGTGGG - Intergenic
954817238 3:53292321-53292343 GGCCCTGAAGGGGCTCTGGTTGG + Exonic
956844158 3:73167031-73167053 GCCTGTGGAGAGGCCCATGTGGG - Intergenic
957386484 3:79502507-79502529 GGCCGTGCAGGAGCCCATGGCGG - Intronic
959974014 3:112437658-112437680 GGCCCTGGAGCAGACCTTGTTGG + Intergenic
961645428 3:128390365-128390387 GGCTCAGGAGGGGTGCATGTGGG + Intronic
961946312 3:130692705-130692727 GGCCCCTGTGGGGCCCCTGTGGG - Intronic
963906777 3:150779447-150779469 GGCGCTGGAGGGGCCGAGGGTGG + Intergenic
964265338 3:154889321-154889343 GGCCGTGCAGGAGCCCATGGCGG + Intergenic
966807495 3:183818538-183818560 GGCTCTGGAGGGGCAGGTGTGGG - Intronic
966854383 3:184184198-184184220 GGCCCAGGAGGGGCCTAACTGGG - Intronic
967834765 3:193951612-193951634 GTGCCTGGAGGAGCCCAGGTCGG + Intergenic
968297184 3:197585706-197585728 GGCCTTGGGAGGGCCCATGTCGG + Intergenic
968810535 4:2797760-2797782 TGCCCTGGTGGTGCCCACGTGGG + Intronic
968915686 4:3496189-3496211 GTCCCTGGAGGAGCCTATGGTGG - Intronic
968916734 4:3499943-3499965 GGGCCTTGGGGGGCCCATGGGGG + Intronic
969454240 4:7292039-7292061 GGCCCTGGAGGGGACCGTCATGG + Intronic
971253802 4:24995544-24995566 GCCTGTTGAGGGGCCCATGTGGG - Intergenic
971489686 4:27198425-27198447 GGCCCAGGAGGAGCCACTGTTGG - Intergenic
973543990 4:51961975-51961997 GGCCCTGTAGTGGCCCCAGTTGG + Intergenic
977652902 4:99490334-99490356 GGCCCGGGACGGGCCCCTCTTGG + Intergenic
977883637 4:102234625-102234647 GGCCATGCAGGAGCCCATGGGGG - Intergenic
980114147 4:128663247-128663269 GACCCTGGAGGGGTCCAGCTTGG - Intergenic
985975346 5:3415825-3415847 GGCCCTGGATAGGTCCAAGTAGG - Intergenic
990656780 5:57965655-57965677 GGCCCTAGAGTGGCTGATGTTGG - Intergenic
992095196 5:73356650-73356672 TGCCCTGGTGGTGCCCATGCAGG - Intergenic
992174246 5:74134010-74134032 GGCCCTGGAGGGGCTGAACTTGG - Intergenic
997659666 5:135579484-135579506 GGCCCAGCAGGGGCCCTTGGGGG - Intergenic
998137495 5:139681886-139681908 GGCCCTGGAGGGGCAAATGAAGG - Intronic
998402262 5:141853972-141853994 GGCCCTGGAATGGGCCATTTGGG + Exonic
1002277458 5:178113426-178113448 GGGCCGGGCGGGGCCCAGGTTGG + Exonic
1002484209 5:179523654-179523676 TGCCCAGGAGGGGACCGTGTGGG + Intergenic
1002904662 6:1438731-1438753 GCCCCTGGAGGGGCCGAAGCCGG - Intergenic
1003113129 6:3265435-3265457 GGCCCTGGAGGGGCACAGCTTGG + Intronic
1004294493 6:14397811-14397833 GGCCCAGGATGAGCCCAGGTCGG - Intergenic
1006446311 6:34081686-34081708 GGCACTTGGTGGGCCCATGTAGG + Intronic
1006787662 6:36679207-36679229 GTCCCTGGAGGGGCCCAGGAAGG + Intronic
1007241335 6:40427857-40427879 GGCTCTGATGGGCCCCATGTAGG - Intronic
1007393997 6:41566916-41566938 GGCCATGGAGGAGCACATGAGGG - Intronic
1007416226 6:41692805-41692827 GGGGCTGGAGGGTCCCATCTTGG + Intronic
1007769384 6:44180704-44180726 GGGGCTGGAGGGGCCCGAGTGGG + Intronic
1008230784 6:48983504-48983526 GGCCATGCAGGAGCCCATGGTGG + Intergenic
1012976578 6:105786689-105786711 CACCCTGGAGGAGCCGATGTAGG + Intergenic
1014109261 6:117602282-117602304 GGCCCTTGACGGCGCCATGTCGG - Exonic
1014150354 6:118047777-118047799 GGGCCTGTTGGGGCGCATGTTGG + Intronic
1017266069 6:152448341-152448363 AGCCCTGGAGTGGCCCTGGTTGG - Intronic
1018799232 6:167209944-167209966 TGCTCTGGAGGGTCCCTTGTCGG - Intergenic
1019154236 6:170028659-170028681 GGCCCTGGAGTGGCACAAGCTGG - Intergenic
1019306014 7:336067-336089 GGCCCTGGATGTCCCCATGGTGG - Intergenic
1019341237 7:510083-510105 GGCCCTGGAGGGTCCTGTGCGGG - Intronic
1019413309 7:916034-916056 GCCCCTGGAGTGGCCCTTCTGGG - Intronic
1019428784 7:989058-989080 GGCCCTGGAGGCGCTCCTGGGGG - Exonic
1019573488 7:1724983-1725005 GGCCCTGGCGAGGCCCCTGTGGG + Intronic
1019609130 7:1928137-1928159 GTCCCTAGAGGAGCCCATGACGG + Intronic
1019746943 7:2705988-2706010 AGCCCTGGAGTGACCCTTGTGGG - Intronic
1021963126 7:25892138-25892160 GGCCCAGGAGGGGGACATGTTGG - Intergenic
1023863759 7:44229311-44229333 GGCTCTGGAGTGGCCCCTCTAGG + Intronic
1024239201 7:47421025-47421047 GACCCTGGGAGGCCCCATGTGGG - Intronic
1024279910 7:47710337-47710359 GGGCCCGGACGGGCCCATGTGGG + Intronic
1024845109 7:53633709-53633731 GGCCCAGGATGGGGCCATGGTGG + Intergenic
1026045807 7:66904522-66904544 GGGCCCGGAGGGGCCACTGTGGG - Intergenic
1027052449 7:75028736-75028758 GGTCCTGGAGATGCCCATGGAGG - Intronic
1028719379 7:94011941-94011963 GGCCATGCAGGAGCCCATGGCGG + Intergenic
1029424392 7:100487041-100487063 GGCCCTGGCGGGGCCAGTGGGGG + Exonic
1029543168 7:101196437-101196459 GCCCCTGGGGGTGCCCATCTCGG - Intronic
1029733704 7:102454056-102454078 AGCCCTGGTGGGGCCCAGGAGGG + Exonic
1032401221 7:131625799-131625821 AGCCCTGGAGGGGCAGGTGTGGG + Intergenic
1032841931 7:135721348-135721370 GGCCCTGCAGGGACCCAGGCAGG + Intronic
1032902136 7:136321459-136321481 AGTACTGGAGGAGCCCATGTGGG + Intergenic
1033480751 7:141738082-141738104 GGCCCAGGAGGGGGCGAGGTAGG - Intergenic
1034429936 7:151036187-151036209 GGGGCTGGAGGGGCGCTTGTGGG + Intronic
1034468317 7:151242720-151242742 GGCTCTGAAGAGGCCCATGAAGG - Exonic
1035039761 7:155919413-155919435 GGGCTTGGAGGGTCCCATGCTGG - Intergenic
1035462925 7:159056279-159056301 GGTCCTGAAGGGGCAAATGTGGG - Intronic
1035605428 8:927042-927064 AGGCCTGGAGGAGCCGATGTGGG + Intergenic
1036588866 8:10149461-10149483 GGCCCTGGAGGGGCCTGGGCAGG - Intronic
1036789542 8:11708812-11708834 GGCCCAGGACGCGCCCACGTCGG - Exonic
1037454997 8:19054101-19054123 GGCCCTAGAGGATCCCATGAAGG - Intronic
1038459675 8:27705253-27705275 AGCCCTGGAGGGAGCCAGGTGGG - Intergenic
1038947215 8:32374622-32374644 GGCCCTGGAGGTGAAGATGTTGG - Intronic
1040323141 8:46328524-46328546 GGCCGTAGACGGGCCCATGCTGG - Intergenic
1044858059 8:96495218-96495240 GGCCCTGGCGGGGCGCTTCTGGG + Intronic
1045266073 8:100619612-100619634 TGCCCTGCAAGGCCCCATGTGGG - Intronic
1047358071 8:124141884-124141906 GGCCCTGGAGGGGCTCTGCTCGG + Intergenic
1049156036 8:141067372-141067394 GGAACTGCAGGTGCCCATGTGGG + Intergenic
1049195697 8:141314526-141314548 TGCCCAGGGCGGGCCCATGTGGG - Intergenic
1049443431 8:142619436-142619458 AGCCCTGGAGGGGACCAGGGTGG + Intergenic
1049564607 8:143331663-143331685 GGCTCTGAAGGGACCCATCTGGG - Intronic
1049586447 8:143434698-143434720 GGGCCTGGAAGGGCCCAGGGTGG + Intergenic
1049588940 8:143446811-143446833 GGCCCCAGAGGGCCCCCTGTGGG - Intronic
1049614140 8:143568969-143568991 GGCCCTGGAGGGGCGGAGCTGGG + Intronic
1049787916 8:144459975-144459997 GTCCCTGGTTGGGCCCATGCTGG - Intronic
1049813259 8:144585770-144585792 GGCCCTGCAGGGGCCCATGAGGG - Intronic
1050453048 9:5804254-5804276 TTCTCTGGAGGGGCCCATCTTGG + Intronic
1054925936 9:70588794-70588816 GGCCCTGGATGGGCCCAGTGGGG - Intronic
1057390548 9:94638914-94638936 GACCTTGGAGGGGCCCACCTGGG - Intronic
1057613428 9:96567132-96567154 GGCACTGGAGGAGCCCTGGTTGG - Intronic
1057886453 9:98833519-98833541 GGCCCTGGGGGGACCGTTGTAGG + Intronic
1058674627 9:107389785-107389807 GGCCTCTGAGAGGCCCATGTGGG - Intergenic
1060022757 9:120146509-120146531 GGCCCTGGATGGCCCCACGGTGG + Intergenic
1060282814 9:122225637-122225659 GACCCTGGAGAGGCCAAAGTCGG + Intronic
1061188705 9:129069804-129069826 GGGCCAGGCGGGGCCCAGGTAGG - Intronic
1061425097 9:130493665-130493687 GGCCCTGCAGCTGCCCAGGTGGG + Intronic
1062404245 9:136387359-136387381 GGCGAGGGAGGGGCCCGTGTGGG - Intronic
1062429991 9:136522741-136522763 AGCCCTGGGAGGGCCCATGGCGG - Intronic
1062485619 9:136773810-136773832 GCCTCAGGAGGGACCCATGTGGG + Intergenic
1062615886 9:137395502-137395524 GTGCCTGGGGGGGCCCAAGTGGG + Intronic
1062624288 9:137435916-137435938 GGCCCAGGAGGGGCCCAGGCTGG - Intronic
1062693211 9:137856442-137856464 GGCCCTAGAGGAGCACATGCAGG + Intronic
1062710394 9:137972173-137972195 AGGCCTGGAGGGGCCCATCCTGG - Intronic
1187046830 X:15655366-15655388 GTCCCTGGAGGGGCCCTTGAAGG - Intronic
1187053060 X:15713559-15713581 GTCCCTGGAGGGGCCCTTGAAGG - Intronic
1192224430 X:69218467-69218489 GGCCCCAGAGGCGCCCAGGTGGG + Intergenic
1192457095 X:71285161-71285183 GGCCCCGGAGAGGCCCAGGATGG - Intronic
1194797133 X:98225642-98225664 GGTCCTGGAGGGGGCCTTCTGGG + Intergenic
1195460236 X:105115824-105115846 GGCCGTGCAGGAGCCCATGGCGG + Intronic
1195678732 X:107527507-107527529 GGGCCTGAAAGGGACCATGTGGG + Intronic
1200212823 X:154354462-154354484 GGCCCCGGAGAGGCCCCTGGTGG - Exonic
1201885808 Y:18880420-18880442 GGCCATGCAGGAGCCCACGTTGG - Intergenic
1202271456 Y:23078414-23078436 GGCCATGCAGGAGCCCATGGCGG + Intergenic
1202294570 Y:23342268-23342290 GGCCATGCAGGAGCCCATGGCGG - Intergenic
1202424451 Y:24712158-24712180 GGCCATGCAGGAGCCCATGGCGG + Intergenic
1202446338 Y:24957927-24957949 GGCCATGCAGGAGCCCATGGCGG - Intergenic