ID: 1176110370

View in Genome Browser
Species Human (GRCh38)
Location 20:63408122-63408144
Sequence GATCCCTCAGGGGTTCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 150}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176110370_1176110376 2 Left 1176110370 20:63408122-63408144 CCACAAGGAACCCCTGAGGGATC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 1176110376 20:63408147-63408169 CCTCTCAGCAGCCCCCACCCAGG 0: 1
1: 0
2: 7
3: 79
4: 594
1176110370_1176110379 12 Left 1176110370 20:63408122-63408144 CCACAAGGAACCCCTGAGGGATC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 1176110379 20:63408157-63408179 GCCCCCACCCAGGACTCCTGGGG 0: 1
1: 1
2: 4
3: 43
4: 413
1176110370_1176110387 26 Left 1176110370 20:63408122-63408144 CCACAAGGAACCCCTGAGGGATC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 1176110387 20:63408171-63408193 CTCCTGGGGACTTTGGCCCTTGG 0: 1
1: 0
2: 2
3: 28
4: 279
1176110370_1176110388 27 Left 1176110370 20:63408122-63408144 CCACAAGGAACCCCTGAGGGATC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 1176110388 20:63408172-63408194 TCCTGGGGACTTTGGCCCTTGGG 0: 1
1: 0
2: 1
3: 20
4: 205
1176110370_1176110377 10 Left 1176110370 20:63408122-63408144 CCACAAGGAACCCCTGAGGGATC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 1176110377 20:63408155-63408177 CAGCCCCCACCCAGGACTCCTGG 0: 1
1: 1
2: 6
3: 67
4: 617
1176110370_1176110385 19 Left 1176110370 20:63408122-63408144 CCACAAGGAACCCCTGAGGGATC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 1176110385 20:63408164-63408186 CCCAGGACTCCTGGGGACTTTGG 0: 1
1: 0
2: 1
3: 49
4: 452
1176110370_1176110378 11 Left 1176110370 20:63408122-63408144 CCACAAGGAACCCCTGAGGGATC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 1176110378 20:63408156-63408178 AGCCCCCACCCAGGACTCCTGGG 0: 2
1: 1
2: 3
3: 41
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176110370 Original CRISPR GATCCCTCAGGGGTTCCTTG TGG (reversed) Intronic
905641865 1:39595515-39595537 GATCCCCCAGTGGTTCCTCCCGG + Intergenic
907798892 1:57744382-57744404 TATCTCACAGGGCTTCCTTGAGG + Intronic
908823874 1:68115160-68115182 GGTCCCTCTGGGGCTCCTTAGGG + Intronic
917359850 1:174163037-174163059 GATGGCTCAGGGGTTTCTTGTGG + Intronic
917928803 1:179809892-179809914 CATGCTTCAGGGGTTTCTTGGGG - Intronic
920299929 1:204982475-204982497 GATCCCTCAAGGCTTCCCCGGGG - Intronic
920518574 1:206605154-206605176 GATCCCTAAGGTCTTCCTTTGGG + Intronic
922482583 1:225949421-225949443 GAGCCCTGAGAGGTTCCTGGTGG + Intergenic
1063927168 10:10991755-10991777 GAGGCCACAGGGGTTCCATGTGG - Intergenic
1065339998 10:24695825-24695847 GATCACTCATGGGTTGCTGGTGG - Intronic
1067730362 10:48806135-48806157 GGCCTCTCAGGGGTTCCGTGAGG - Intronic
1068488189 10:57686570-57686592 GATCCCTCAGTGTTTACTTCTGG - Intergenic
1070711058 10:78683520-78683542 AATCCCTCAGAGGCTCCTGGAGG + Intergenic
1072318743 10:94228349-94228371 GATCACACAGGTATTCCTTGGGG - Intronic
1074894747 10:117765469-117765491 GATGCCTCAGAGGTGCCTTGGGG - Intergenic
1075555020 10:123424350-123424372 GATCCCTGAGGTGATCCCTGAGG + Intergenic
1077902335 11:6499369-6499391 CATTCCCCAGGGGTACCTTGAGG - Intronic
1084691115 11:70727382-70727404 ATTCCCTGAGGGGTTCCTTCGGG + Intronic
1084863542 11:72038401-72038423 GGTCCTTCAGGAGTTCCTAGTGG - Intronic
1087368265 11:97248824-97248846 GATGCCTGTGGGATTCCTTGTGG + Intergenic
1091047814 11:132340468-132340490 CATCCCTCAAGTTTTCCTTGAGG - Intergenic
1091798933 12:3312560-3312582 GATCTCTGAAGGGTTCCCTGGGG + Intergenic
1094493170 12:30973946-30973968 GAGCTCTCAGTGTTTCCTTGGGG - Intronic
1095269844 12:40204807-40204829 GCTCCCTCAGAGGTACCCTGTGG + Intronic
1100214263 12:92431339-92431361 GGTCCCTGGGAGGTTCCTTGTGG + Intergenic
1102230003 12:111256035-111256057 GACCACTCAGGGGTGCTTTGGGG - Intronic
1102872714 12:116426540-116426562 GATCCCTCAGGGGCTTCTGGGGG + Intergenic
1104690038 12:130818718-130818740 GTTCCCTCAGCCGTTCCCTGGGG - Intronic
1106832578 13:33601437-33601459 AGTGCCTCAGGGGTTTCTTGGGG + Intergenic
1107223814 13:38021473-38021495 GATCCCTCAAGCATTTCTTGTGG + Intergenic
1112396198 13:99034565-99034587 CACCCCTCAGGGGTGCCATGAGG + Intronic
1113145532 13:107203657-107203679 GGGCCCTCAGTGGTTCCCTGGGG + Intronic
1114438973 14:22730906-22730928 AATCCCTCAGGGATGCCTCGGGG + Intergenic
1118235222 14:63996988-63997010 GCTCCCTCAGGACTTCCATGTGG - Exonic
1119743092 14:77026909-77026931 GCTCCCCCAGGGGCTCCTGGGGG - Exonic
1124824987 15:33084724-33084746 GAAGACTCAGGGGTTCCTTGGGG - Intronic
1125343858 15:38699366-38699388 TGTCTCTCAGGGGTTCCTTCTGG + Exonic
1128983996 15:72206229-72206251 GCTCCCGCAGGGGGCCCTTGTGG - Intronic
1129457007 15:75681409-75681431 GACCCCTCAGGAGGTACTTGGGG + Intronic
1130768923 15:86904230-86904252 GATCTCTCTGGGTTTCCTTTGGG - Intronic
1132259359 15:100408637-100408659 GATCCCTCTGGATTTCCCTGCGG + Intronic
1132511602 16:345111-345133 GATCCCTGCGTGGTTCCTGGAGG - Intronic
1132621854 16:871521-871543 GATGCCTCAGAGGTGCCTTCCGG + Intronic
1134562324 16:15221178-15221200 GATCCCTCAGGGGCTCATGCAGG - Intergenic
1134922865 16:18132805-18132827 GATCCCTCAGGGGCTCATGCAGG - Intergenic
1136715348 16:32277319-32277341 GTTCCCATAGGGGTTTCTTGTGG + Intergenic
1136752567 16:32652410-32652432 GTTCCCATAGGGGTTTCTTGTGG - Intergenic
1136822024 16:33328031-33328053 GTTCCCATAGGGGTTTCTTGTGG + Intergenic
1136828587 16:33384570-33384592 GTTCCCATAGGGGTTTCTTGTGG + Intergenic
1136833653 16:33483344-33483366 GTTCCCATAGGGGTTTCTTGTGG + Intergenic
1137701326 16:50500103-50500125 GGTACCTCCAGGGTTCCTTGTGG + Intergenic
1138134174 16:54507464-54507486 GTTCCCTTTGGGGTCCCTTGGGG + Intergenic
1138565790 16:57831904-57831926 GATCCCTCATGATTTCTTTGGGG + Intronic
1139440995 16:66966775-66966797 TCTCCTTCAGGAGTTCCTTGGGG - Exonic
1139681727 16:68570225-68570247 GATCCCTGATGGATTCCATGTGG + Intronic
1141994011 16:87625639-87625661 GATCTAACAGGGGTTCCTGGGGG + Intronic
1203011263 16_KI270728v1_random:241178-241200 GTTCCCATAGGGGTTTCTTGTGG - Intergenic
1203054706 16_KI270728v1_random:912450-912472 GTTCCCATAGGGGTTTCTTGTGG - Intergenic
1143173244 17:4942331-4942353 CATCCTTCAGGGGTTCCTTGTGG + Exonic
1143407748 17:6689223-6689245 GACCCCTCAGTGGTTCCCAGGGG - Intronic
1146185191 17:30720064-30720086 GATGCCTGAGGGCTTCCTGGAGG + Intergenic
1152036814 17:77878589-77878611 AATCCATCAGTGGTTGCTTGGGG - Intergenic
1152895901 17:82911079-82911101 GCTCCTTCAGGTGCTCCTTGGGG + Intronic
1158850985 18:61495772-61495794 GATGCCTCGGGGCTTCCTTCTGG + Intronic
1161363353 19:3863911-3863933 GAGCCCTCACGTGATCCTTGGGG - Intronic
1162248751 19:9425189-9425211 TATCCCTCAGGACTTCCTTTGGG - Intronic
1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG + Intronic
1166377766 19:42337188-42337210 TCACCCTCAGGGGTTCCTGGCGG - Exonic
1167288139 19:48610462-48610484 CAACCCTCAGGCGTTTCTTGGGG + Intronic
1167586673 19:50379198-50379220 GCTATCTCTGGGGTTCCTTGTGG - Intronic
926239354 2:11073211-11073233 GATTCCTCAGGAGTTCTGTGGGG + Intergenic
926370547 2:12174581-12174603 GTTGCCTCATGGGTTCCTAGTGG - Intergenic
926564683 2:14456271-14456293 GATCCCTTAGGTGTTGCTTCTGG - Intergenic
929543561 2:42841177-42841199 CATCCCTAGGGGGGTCCTTGAGG - Intergenic
929558227 2:42938626-42938648 GAGCCCTCAAGGGTTTTTTGGGG - Intergenic
930016623 2:46975070-46975092 GATCGCTCAGGTGTTCCTGCAGG + Exonic
935254087 2:101292911-101292933 GATCACTCAGAAGGTCCTTGGGG - Intronic
937063079 2:118994585-118994607 GATCTCTGAGGAGTTCCCTGGGG + Exonic
941869365 2:170367452-170367474 GTTCCCTCTGAGGTTCCTGGGGG + Intronic
943756021 2:191558246-191558268 TATGCCTCAAGGGTTCCTTGAGG - Intergenic
944514123 2:200494229-200494251 GACCGCTTAGGGGTTCCTTTTGG + Intronic
944721708 2:202429249-202429271 AATTCTTCAGTGGTTCCTTGTGG + Intronic
945071875 2:205998854-205998876 TATGTCTCAGGGATTCCTTGTGG - Exonic
946153944 2:217794644-217794666 GCTCCTTCAGGTGCTCCTTGAGG + Intergenic
946490303 2:220143120-220143142 GTTCCCTCAGGGGTACCATTAGG + Intergenic
948264133 2:236625177-236625199 GAGCACTCAGGAGTTCCCTGTGG - Intergenic
1168906390 20:1407388-1407410 GCTCCCTCTGGGGGTCCTAGGGG - Intergenic
1169604536 20:7301962-7301984 GATCTCTAAGTGGTTGCTTGAGG - Intergenic
1169872582 20:10263372-10263394 GCTCCCTTAGGGGTTCTTTGTGG - Intronic
1171155992 20:22874703-22874725 GATTCCTCAGGGATTCCTCAAGG - Intergenic
1171533593 20:25867822-25867844 GAAGCCTCAGGGGTTGCGTGGGG - Intronic
1174433627 20:50489635-50489657 GATCCCTCATGGATGGCTTGGGG + Intergenic
1176110370 20:63408122-63408144 GATCCCTCAGGGGTTCCTTGTGG - Intronic
1177103866 21:16930856-16930878 CATCCCTGTGGGGTTCCTTTGGG - Intergenic
1177600959 21:23313099-23313121 GATTCATCAGGGGTTACTTTAGG + Intergenic
1179805693 21:43835662-43835684 GATCCTCCAGGGGCTCCCTGTGG - Intergenic
1184981919 22:48101150-48101172 CATCACTCAGGGGATCCTTGAGG + Intergenic
1185413898 22:50699500-50699522 GAACCCTCAGGGGTCCCGGGAGG + Intergenic
950551311 3:13667798-13667820 GATCTCTCAGGGGTACGGTGTGG + Intergenic
953866088 3:46584756-46584778 CATCCCAGAGGGGTTTCTTGAGG + Intronic
954286761 3:49624993-49625015 GGTTACCCAGGGGTTCCTTGGGG - Exonic
954377289 3:50201902-50201924 GGGCCCTCAGGGGCACCTTGAGG - Intergenic
954714040 3:52518305-52518327 TATCCCTCAGGAGCTCCTGGGGG - Exonic
959837284 3:110934761-110934783 GATGACTGAGGGGTTCTTTGGGG - Intergenic
963764941 3:149324775-149324797 GATCACTTTGGGGTTCCATGTGG - Intronic
966425176 3:179773143-179773165 GATCCCTCATGAATACCTTGTGG + Intronic
967182544 3:186919037-186919059 GATGCTTCAGGAGTTCTTTGGGG - Intergenic
967796162 3:193601220-193601242 GATTCCACTGGGGTTCCTGGGGG - Intronic
968442820 4:633185-633207 GAGCCCTCAGGGGTTGCAGGTGG + Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968704881 4:2073191-2073213 GGGCACTCAGGGGCTCCTTGTGG - Intronic
969906709 4:10403852-10403874 GACCCCTCAGTGCTTCCTGGTGG - Intergenic
972219249 4:36935539-36935561 GGTCCCTCAGGGTTTCCCTTGGG - Intergenic
984183637 4:176515394-176515416 GATGCCCCAGGGTTTCCTTGAGG - Intergenic
984991264 4:185383795-185383817 CATCCCTCCGGGCTTCCTTTGGG + Intronic
985512545 5:320882-320904 GTACCCTCAGGGGATCCCTGGGG - Intronic
985783420 5:1882316-1882338 CCTTCCCCAGGGGTTCCTTGGGG + Intronic
987712780 5:21524091-21524113 GATAACTCAAGGTTTCCTTGAGG - Intergenic
989709216 5:44376549-44376571 GATGCTTCAGGTGTTCCTTTTGG + Intronic
995455449 5:112347217-112347239 GATCCATTAGGGGATCCATGAGG + Intronic
998453251 5:142250794-142250816 AATCCCACAGGTTTTCCTTGTGG - Intergenic
998665746 5:144295480-144295502 GACCCTTCAGGGGTTTCTGGAGG + Intronic
999696332 5:154190972-154190994 GATCCCCCAGGGGTGCCGTCGGG - Exonic
1004570931 6:16844249-16844271 GATGACTCAGGGGTTCTGTGGGG + Intergenic
1004828313 6:19448673-19448695 GATCCCTCAAAGGTCCCTAGTGG + Intergenic
1006838197 6:37011862-37011884 GAGGCCTCAGGGGCTCCTGGTGG - Intronic
1009003935 6:57757828-57757850 GATAACTCAAGGTTTCCTTGAGG + Intergenic
1017818380 6:158031272-158031294 GAACCCCTAGGGGATCCTTGGGG + Intronic
1017931127 6:158956695-158956717 GCTCCCTCATGGGTTCTTTGAGG - Intergenic
1021820496 7:24493282-24493304 GAACCCTCAGGGATTCTTTCAGG + Intergenic
1023021255 7:36013785-36013807 GATCCCTCATGTGTTGCTGGTGG - Intergenic
1024082074 7:45864234-45864256 GATCCCACAGAGGGGCCTTGTGG + Intergenic
1026296657 7:69058846-69058868 TAGCCCTCAGGTGTACCTTGTGG + Intergenic
1029361091 7:100089099-100089121 CCTCCTTCAGGGGTTCGTTGAGG + Intronic
1033082334 7:138310101-138310123 TATCCCTGTGGGCTTCCTTGAGG - Intergenic
1033269217 7:139915654-139915676 GATCCCTCATGGGATGCTTACGG - Intronic
1033672320 7:143504897-143504919 GATCCCTCAGCTGCTCCTGGTGG - Intergenic
1040857464 8:51962693-51962715 CCTCCCTCAGGGCTTGCTTGTGG - Intergenic
1041633544 8:60116490-60116512 CATCCCTCAGGGCTTCCTTCAGG - Intergenic
1042829365 8:73009561-73009583 GATGCCTCGGGGGTTACTGGAGG - Intronic
1043631883 8:82345612-82345634 GATACTCCAGGGGTTCCTCGTGG + Intergenic
1044529213 8:93289139-93289161 GATCACACAGGGCTTCCCTGAGG + Intergenic
1049215220 8:141404715-141404737 AGGCCCTCAGGGGGTCCTTGAGG - Intronic
1052375819 9:27716507-27716529 GATCCCTCAGGAGATGCTTCAGG - Intergenic
1056998694 9:91487857-91487879 GCACCCTCAGGAGTTCCTGGCGG - Intergenic
1058723799 9:107783369-107783391 AATCTTTCAGGGGGTCCTTGAGG + Intergenic
1058887572 9:109333147-109333169 GAACCCTCAGGCATTCCTGGTGG + Intergenic
1059029744 9:110678351-110678373 GATCCTTCAGTGGATCCTTCTGG + Intronic
1060229220 9:121814598-121814620 GAGCCCTGAGGGGATCCTGGGGG + Intergenic
1061042615 9:128148832-128148854 GGTCCCTCAGGGGTCCACTGGGG + Intergenic
1061941611 9:133887050-133887072 GTTCCCAGAGGGGTTCCCTGGGG + Intronic
1185546191 X:947612-947634 GATCCCTCAAGGGTCCCAAGGGG + Intergenic
1185546205 X:947683-947705 GATCCCTCAAGGGTCCCAAGGGG + Intergenic
1185546219 X:947754-947776 GATCCCTCAAGGGTCCCAAGGGG + Intergenic
1185546236 X:947824-947846 GGTCCCTCAGGGGTCCCAAGGGG + Intergenic
1185871031 X:3665000-3665022 GATCCCTCTGGGGTATTTTGAGG - Intronic
1187503945 X:19863743-19863765 AAAGCCTCAGGGGTTCATTGTGG - Intronic
1191934264 X:66409413-66409435 GATCCCACATGTGTTGCTTGGGG + Intergenic
1195758875 X:108225178-108225200 GATGTCTTAGGGGGTCCTTGAGG + Intronic
1196135618 X:112206597-112206619 GGTTCCTCAGGGCTTCATTGTGG + Intergenic
1198161923 X:134016576-134016598 AATCCTTCAAGGGGTCCTTGTGG - Intergenic
1200793057 Y:7316512-7316534 GATCCCTCTGGGGTATTTTGAGG + Intergenic