ID: 1176113062

View in Genome Browser
Species Human (GRCh38)
Location 20:63419213-63419235
Sequence GGAGCTGCCTCCCGCGGTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176113059_1176113062 -7 Left 1176113059 20:63419197-63419219 CCCGGCACACACAGACGGAGCTG 0: 1
1: 0
2: 2
3: 15
4: 209
Right 1176113062 20:63419213-63419235 GGAGCTGCCTCCCGCGGTCGAGG 0: 1
1: 0
2: 0
3: 14
4: 76
1176113056_1176113062 3 Left 1176113056 20:63419187-63419209 CCCTGAGGAGCCCGGCACACACA 0: 1
1: 0
2: 0
3: 16
4: 135
Right 1176113062 20:63419213-63419235 GGAGCTGCCTCCCGCGGTCGAGG 0: 1
1: 0
2: 0
3: 14
4: 76
1176113057_1176113062 2 Left 1176113057 20:63419188-63419210 CCTGAGGAGCCCGGCACACACAG 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1176113062 20:63419213-63419235 GGAGCTGCCTCCCGCGGTCGAGG 0: 1
1: 0
2: 0
3: 14
4: 76
1176113060_1176113062 -8 Left 1176113060 20:63419198-63419220 CCGGCACACACAGACGGAGCTGC 0: 1
1: 0
2: 2
3: 17
4: 237
Right 1176113062 20:63419213-63419235 GGAGCTGCCTCCCGCGGTCGAGG 0: 1
1: 0
2: 0
3: 14
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176113062 Original CRISPR GGAGCTGCCTCCCGCGGTCG AGG Intronic
900206937 1:1435636-1435658 GGAGGGGCCTCCCGGGGGCGGGG + Intronic
900269309 1:1778844-1778866 GGAGGTCCCGCCCGCGGTGGCGG - Intronic
900501782 1:3009442-3009464 GGAGCTGCCTCCCCCTCTAGAGG + Intergenic
901780994 1:11594446-11594468 GGAGATGCCTCCCGTGATTGTGG + Intergenic
917860483 1:179138861-179138883 GGGGCTGCCTGCCGCGCTTGCGG + Intronic
920528746 1:206686161-206686183 GGAGCCGCCCCGCGCGGGCGTGG - Intronic
1063093618 10:2890170-2890192 GAGGCTGCCTCCCGGGTTCGTGG - Intergenic
1072700930 10:97640901-97640923 GTGGCTGCCGCTCGCGGTCGTGG - Exonic
1072758706 10:98038469-98038491 CCACCTGCCTCCCGCGGTAGAGG - Intergenic
1076796953 10:132803063-132803085 GGAGCTGCCTCACCCCATCGTGG + Intergenic
1076796960 10:132803093-132803115 GGAGCTGCCTCACCCCGTCGTGG + Intergenic
1077137499 11:1008336-1008358 GGAGCTGCCACCTGCCGTCCCGG - Intronic
1082817044 11:57515740-57515762 GGAGCTGCGCCCCGAGGTGGGGG + Exonic
1083767550 11:64849087-64849109 GGAGCTGCTTCCCGAGGCCACGG - Intergenic
1083843251 11:65316321-65316343 GGAGCTCCCTGCAGCAGTCGGGG - Intronic
1103027790 12:117587858-117587880 AGAGCTCCCTCTGGCGGTCGAGG + Intronic
1103309092 12:119989940-119989962 GGAGCTGCCCGCCGCGGCCGGGG + Exonic
1103505993 12:121442678-121442700 GGTGCTGGGTCCCGCGGTGGGGG + Exonic
1104947438 12:132422418-132422440 GGAGCTGCCGCCCCTGGTCATGG - Intergenic
1105006910 12:132727280-132727302 GGAGCTGGCTCCCGTGCACGGGG + Exonic
1106422463 13:29595379-29595401 GGAGCTGCCCCCTGCGTTGGCGG + Intronic
1111990978 13:95117007-95117029 GGAGCTGCCTCCCGCTGCTGGGG + Intronic
1114670461 14:24408207-24408229 GCAGCTGCCCCCAGCGGTCCAGG + Exonic
1117424630 14:55580869-55580891 GCCGCTGCCTCCGGCGGTCTGGG + Intronic
1122770207 14:104094513-104094535 GGAGCTGCCTCCCCTAGTAGGGG + Intronic
1126738114 15:51751801-51751823 GGAGCATCCTCCCGCGGGCAGGG - Intronic
1127960252 15:63885240-63885262 GGAGCTGCCTCCCACAATCCTGG - Intergenic
1129220278 15:74128378-74128400 GGAGCTGACTCCCGCGGGCCCGG - Exonic
1132973191 16:2698832-2698854 GGAGCTGCGTCCCGCGCCCCGGG + Intronic
1136268099 16:29132490-29132512 GGAGGGGCCTCCCAGGGTCGAGG - Intergenic
1136371863 16:29841655-29841677 AGAGCTGCCTCCCGGGGTGGAGG + Exonic
1136398651 16:30006203-30006225 TGAGCTGCCCCCTGCGGCCGGGG - Exonic
1140255160 16:73329464-73329486 GGATCTGGCTCCGCCGGTCGAGG - Intergenic
1141901646 16:86995013-86995035 GGAGGTGCCTCCCGCGGTGCAGG + Intergenic
1142071408 16:88092828-88092850 GGAGGGGCCTCCCAGGGTCGAGG - Intronic
1142349786 16:89574838-89574860 TGTGCTGCCTCCCGCCGGCGGGG + Intergenic
1145222340 17:21099656-21099678 GGAGCTGCCTCCCCAGGATGGGG + Intergenic
1145310156 17:21696996-21697018 GGAGCTGACTCCCGCTGGGGAGG + Intronic
1147453397 17:40519935-40519957 GGAGCTGCTCCCAGCTGTCGAGG - Intergenic
1148090345 17:45019433-45019455 GGCGCTGCCTCCCGCGGGCCGGG - Intergenic
1151658399 17:75506406-75506428 GGAGCTGCCTGCAGTGGACGGGG + Exonic
1151797201 17:76354105-76354127 GGAGCAGCCTACCTCGGTAGTGG + Exonic
1152583237 17:81178297-81178319 GGGGCTGTCTGCCGGGGTCGGGG - Intergenic
1152625517 17:81386456-81386478 GGGGCTGCCTCCCGCAGGCCAGG + Intergenic
1160540534 18:79617847-79617869 GGAGCTGACACCCTCGGGCGGGG - Intergenic
1161203656 19:3029252-3029274 GGAGCCGCCTCCCTCCGGCGGGG + Intronic
1167709908 19:51104221-51104243 GGAGCTGCCGCTCACGGTCGTGG - Exonic
933774037 2:85761091-85761113 GGAGCTGCCTCTAGGGGTCGGGG + Intronic
933849630 2:86355457-86355479 GGAGCTGCCTCCCTGGCTCCCGG - Intergenic
934675470 2:96246719-96246741 GGAGCTTCCTCCTGTGGTCCAGG - Intergenic
1169143684 20:3239342-3239364 GGAGCAGCCTCCCGCGGGTGAGG - Intergenic
1170578396 20:17681316-17681338 GGAGCCGCCTCCCGCACTCCGGG + Intronic
1171227139 20:23451277-23451299 GGAGCTGCCTTCGGGGGTGGTGG + Intronic
1172774232 20:37397892-37397914 GGAGCTGCCACACGGGGTGGGGG - Intronic
1173245060 20:41331152-41331174 GGGGCTGCCTCCAGCAGTCTGGG - Intergenic
1175280946 20:57803763-57803785 GGCGCTGCCTGCCGGGGTTGGGG - Intergenic
1176086310 20:63297042-63297064 GAGGCTGCCTCCCGCGATGGGGG - Intronic
1176113062 20:63419213-63419235 GGAGCTGCCTCCCGCGGTCGAGG + Intronic
1183802331 22:40177186-40177208 AGAGCTACCTCCTGCGGTGGGGG + Intronic
1184319653 22:43730729-43730751 GCACCTGCCTCACGTGGTCGTGG + Intronic
958949418 3:100400811-100400833 GCAGCTGGCTCTGGCGGTCGGGG - Exonic
962754772 3:138458964-138458986 GGGGCTGCCTCCTGGGGTCTGGG + Intronic
963643040 3:147881571-147881593 GGAGCTGACTCCCTTGGTGGAGG + Intergenic
969454940 4:7295349-7295371 GGTGCTGCCTGCTGCGGTCCTGG - Intronic
971301075 4:25442867-25442889 GGAGCTGCCTCCCGATGGGGAGG + Intergenic
978617407 4:110611297-110611319 GGAGCTGCCTCTCGAGGCCCGGG - Intergenic
1002184591 5:177448116-177448138 GGATCTGAAGCCCGCGGTCGGGG - Intronic
1004220578 6:13743223-13743245 GGGGCTGCCTGCCGCGCTTGCGG + Intergenic
1006313432 6:33277240-33277262 GCAGCTGCGGACCGCGGTCGAGG - Exonic
1007786134 6:44280372-44280394 GGAGCTGCTTCCCACCGTCCTGG + Exonic
1009587617 6:65627548-65627570 GGGGCTGCCTGCCGCGCTTGCGG + Intronic
1019264884 7:109380-109402 GGACCTGCCTCCCGCAGTTGGGG - Intergenic
1019327845 7:446897-446919 GGAGCTGCCTCCCGAGGACTGGG + Intergenic
1025261691 7:57424688-57424710 GGAGCTGCCCCGCGGGGTCCTGG + Intergenic
1029458573 7:100683037-100683059 CGAGCTGGCTCCCGAGGTGGGGG + Exonic
1029735681 7:102464707-102464729 GGAGCTGCCCCCAGCGGTAAGGG - Exonic
1035172034 7:157022152-157022174 GGGGCAGCCTCCCCCGGTCAGGG + Intergenic
1044719788 8:95134100-95134122 GGCGCTTCCTCCCGCGGTCCCGG + Intronic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1053393687 9:37753645-37753667 GGAGCTGCGTCCTGCTGTGGTGG - Intronic
1057182619 9:93038088-93038110 GGAGGTGGCTCCCGGGGTCTCGG + Intergenic
1057613260 9:96566523-96566545 GGATCTCGCTCCCGCGGGCGGGG + Intronic
1057665040 9:97038671-97038693 GGAGCTGCCTGCCTCGGTCCGGG - Intronic
1057739207 9:97697217-97697239 GGAGCTGCCTGCCTCGGTGCGGG - Exonic
1060700939 9:125748016-125748038 GGCGCCGGCTCCCGCGGCCGCGG + Intronic
1061408413 9:130405262-130405284 GGAGCTGGCTACCGAGGTCCAGG - Intronic
1061883645 9:133580058-133580080 GGGGCTCCCTCCCGAGGTAGGGG + Intronic
1062340885 9:136093630-136093652 GGAGCTGCCACCCAAGGTGGTGG - Intronic
1062435771 9:136546019-136546041 TGCGCTCCCTCCCGCGGCCGAGG + Intergenic
1192809804 X:74537733-74537755 GCAGTTGCCTCCCACGGTTGGGG - Intergenic
1196762381 X:119211219-119211241 GGAGCTGCCTGCGGCGCTTGCGG - Intergenic